ID: 1092937526

View in Genome Browser
Species Human (GRCh38)
Location 12:13377946-13377968
Sequence GAATGACATCATAGGGTTAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 147}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092937520_1092937526 18 Left 1092937520 12:13377905-13377927 CCTGCAAATCCCTTTTGACATGC 0: 1
1: 0
2: 1
3: 7
4: 187
Right 1092937526 12:13377946-13377968 GAATGACATCATAGGGTTAACGG 0: 1
1: 0
2: 0
3: 9
4: 147
1092937521_1092937526 9 Left 1092937521 12:13377914-13377936 CCCTTTTGACATGCAGTATAGCA 0: 1
1: 0
2: 0
3: 16
4: 220
Right 1092937526 12:13377946-13377968 GAATGACATCATAGGGTTAACGG 0: 1
1: 0
2: 0
3: 9
4: 147
1092937522_1092937526 8 Left 1092937522 12:13377915-13377937 CCTTTTGACATGCAGTATAGCAT 0: 1
1: 0
2: 3
3: 30
4: 195
Right 1092937526 12:13377946-13377968 GAATGACATCATAGGGTTAACGG 0: 1
1: 0
2: 0
3: 9
4: 147
1092937519_1092937526 29 Left 1092937519 12:13377894-13377916 CCTTAATTACACCTGCAAATCCC 0: 1
1: 4
2: 42
3: 201
4: 708
Right 1092937526 12:13377946-13377968 GAATGACATCATAGGGTTAACGG 0: 1
1: 0
2: 0
3: 9
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092937526 Original CRISPR GAATGACATCATAGGGTTAA CGG Intronic
908097315 1:60752485-60752507 GACTTACATCATAGGATTTAAGG + Intergenic
909275615 1:73682475-73682497 GAGTGACATCATAGGGTATTTGG + Intergenic
909866676 1:80682235-80682257 GAATGACATGAAAGGATCAACGG - Intergenic
910619666 1:89238943-89238965 GTATGACATTATTGGATTAAAGG + Intergenic
913266597 1:117051181-117051203 GGATGAAATCATAGGGTAGAAGG - Intergenic
917498696 1:175566247-175566269 AAACTACATCATAGGGTAAAAGG - Intronic
918656870 1:187037738-187037760 GAAAGATATCTTTGGGTTAAAGG + Intergenic
919579587 1:199355116-199355138 GAATGACATCAGAGGGCCAGTGG - Intergenic
920673316 1:208021386-208021408 GCATGACCTCCTAGGGTTAAGGG + Intergenic
920796758 1:209145237-209145259 GAATGACATGATTAGGTTAAAGG + Intergenic
922909466 1:229203631-229203653 CAATGACATCATGGAGGTAAAGG - Intergenic
924299839 1:242626155-242626177 GAAGGAAATCACAGGGTAAAAGG + Intergenic
924750098 1:246879411-246879433 GAATAAAATCCTAGGGTGAAAGG - Intronic
1063124588 10:3127399-3127421 GAATGACATCAACCGCTTAATGG - Intronic
1063206062 10:3831927-3831949 GAATGACATAATAGGGACACAGG + Intergenic
1063983959 10:11481067-11481089 GAATGATAACAGAGGGTGAATGG - Intronic
1066267956 10:33794623-33794645 GAATGAAATCATAGGGGTGTAGG + Intergenic
1067524146 10:47028206-47028228 GAGTGACCCCATAGGGTTACTGG - Intergenic
1071890161 10:89996136-89996158 AAATGACATCAAATGGTTGAAGG - Intergenic
1072546461 10:96443177-96443199 GCATGACCTCACAGGGATAAGGG - Intronic
1078681153 11:13477388-13477410 GAATGTCATCAATGTGTTAATGG + Intergenic
1080121775 11:28686239-28686261 AAATGACTTCATAGGATTTATGG - Intergenic
1081191132 11:40104237-40104259 AAATGACAACATAGGTTAAAAGG + Intergenic
1083175731 11:60948948-60948970 CAATGAAATAATAGGATTAAAGG + Intronic
1084578890 11:70009944-70009966 GAATGACATCATAGACTCTAGGG - Intergenic
1092937526 12:13377946-13377968 GAATGACATCATAGGGTTAACGG + Intronic
1095331794 12:40974774-40974796 CACTTACATCATAGGGTTATTGG + Intronic
1096861550 12:54532340-54532362 GAAGAACACCATAGGGATAAGGG + Intronic
1097333311 12:58355662-58355684 GAATGTCTTCATAGGGGTGAGGG + Intergenic
1098577571 12:72060567-72060589 CAATGAAATCATAGAGGTAAGGG - Intronic
1101614355 12:106321656-106321678 TAATGATATCAGAGAGTTAAAGG + Exonic
1102654513 12:114470318-114470340 TATTGACCTCATAGGGTTATTGG + Intergenic
1106202203 13:27548619-27548641 GAAAGCCAGCATAGGCTTAAGGG - Intronic
1107176161 13:37401203-37401225 AAATTAGTTCATAGGGTTAAAGG + Intergenic
1108871532 13:54992776-54992798 GAACGACATCATAGAAATAATGG - Intergenic
1108993552 13:56695186-56695208 GCAGGACAACATATGGTTAAAGG - Intergenic
1109671823 13:65618646-65618668 GAATGATATCATAGGTTTAGTGG - Intergenic
1109787820 13:67204460-67204482 GAATGACATGAGAGGATTAATGG - Intronic
1112023200 13:95389970-95389992 GGATGACATCAGAGGATGAATGG - Intergenic
1116132699 14:40877955-40877977 GAATGACCTTATAGGGATAAAGG + Intergenic
1117447319 14:55816532-55816554 AAAAGACATACTAGGGTTAAGGG - Intergenic
1119344577 14:73912469-73912491 GAATGAAATCAAAAGGTGAAAGG - Intronic
1121680834 14:95791529-95791551 GAAAGACAGCATGCGGTTAAAGG - Intergenic
1123497402 15:20842034-20842056 AAATGACGACATAAGGTTAACGG + Intronic
1123554637 15:21415676-21415698 AAATGACGACATAAGGTTAACGG + Intronic
1123590882 15:21852990-21853012 AAATGACGACATAAGGTTAACGG + Intergenic
1123698324 15:22895664-22895686 GAAAGACAGCATGGGGTTAGAGG + Intronic
1126403705 15:48301415-48301437 GAAATAAATCTTAGGGTTAATGG + Intronic
1127053685 15:55110983-55111005 CAATGACATCTTAGGTTTAATGG + Intergenic
1131467266 15:92665843-92665865 GCATGACATCAAGGGGATAAGGG - Intronic
1202962980 15_KI270727v1_random:142870-142892 AAATGACGACATAAGGTTAACGG + Intergenic
1134326211 16:13210181-13210203 GAATTACATAAAAGGGTGAAAGG - Intronic
1139843044 16:69897478-69897500 GAATGAGATCAGAGAGTTCATGG - Intronic
1140075517 16:71695230-71695252 GAATGAAATTATTGGGTTATAGG - Intronic
1141619654 16:85230193-85230215 CAATGCCAGCATGGGGTTAAAGG - Intergenic
1144368889 17:14571103-14571125 GAATGATATCTTAGGGTAACTGG - Intergenic
1145929363 17:28673896-28673918 AAATGACTTCAAAGGGGTAAAGG + Intronic
1147555025 17:41473133-41473155 GTAAGACATCAGAGGGTGAAAGG + Intergenic
1150017550 17:61573445-61573467 TATTAACATCACAGGGTTAATGG + Intergenic
1150070491 17:62146132-62146154 CAATGACTTAATAGGGGTAAGGG - Intergenic
1153341184 18:3976718-3976740 TAATGAAATCATGGAGTTAAAGG + Intronic
1157330974 18:46703604-46703626 GAATCACATCAGATGGGTAAAGG + Intronic
1157334438 18:46727786-46727808 GCATGAGAACATGGGGTTAAAGG - Intronic
1158346874 18:56524793-56524815 GAATGACTTCATAGTGTTGGCGG + Intergenic
1160089240 18:75810647-75810669 GAATGACATCATGTGTTCAATGG + Intergenic
929044835 2:37779177-37779199 GAATGCCATCATCGGGTCACAGG - Intergenic
930744962 2:54872867-54872889 CAATGACAACAAAGGGCTAAGGG - Intronic
931677527 2:64712678-64712700 GTATTACCTCATAGGGTTGAAGG + Intronic
931752512 2:65342971-65342993 AAATTACATCAAAGGGCTAAGGG + Intronic
937200275 2:120198835-120198857 GAAAGACATCATATGGTCATAGG + Intergenic
938322806 2:130376449-130376471 TAAAGACATCATTGGGTTTAGGG - Intergenic
942625260 2:177893575-177893597 GATTGATATCAAGGGGTTAAGGG - Intronic
1170382648 20:15778081-15778103 GATTGACCTCATGGGGTTAGTGG - Intronic
1170619935 20:17987200-17987222 GAATGGCATCCTAGAGTTACTGG + Intronic
1175734939 20:61378688-61378710 AAATGACATCATAGGTTCTAGGG + Intronic
1176684541 21:9837001-9837023 GAATGACCTCATAGGTCTCAAGG + Intergenic
1177722191 21:24921596-24921618 GAATGACATCATTGTTATAAGGG - Intergenic
1183948233 22:41338775-41338797 GATTGACATCATAGGACTGAGGG + Intronic
952586201 3:34895439-34895461 TAATGCCATCAAAGGATTAAAGG + Intergenic
954989643 3:54829669-54829691 GTAGCACATAATAGGGTTAATGG - Intronic
956346073 3:68280502-68280524 GCAGGATATCATATGGTTAAAGG + Intronic
957023092 3:75146393-75146415 GGATGACAGTATAGGGTTAGAGG + Intergenic
960598200 3:119427135-119427157 GAAGGACATCATATGATAAAAGG - Intergenic
963217656 3:142767791-142767813 GAATGACATCTTTTGCTTAATGG + Intronic
963644841 3:147900966-147900988 GGATGAAATCATAGGGGTATGGG + Intergenic
965028056 3:163328156-163328178 AAATGACAACAGAGGTTTAAAGG + Intergenic
966920290 3:184606707-184606729 AAATGACATCAATGGGTTAATGG + Intronic
967783529 3:193465527-193465549 AAATGATATCAGTGGGTTAAAGG + Intronic
970943512 4:21663236-21663258 AAATGTCATCAAATGGTTAATGG + Intronic
971211946 4:24626838-24626860 GAGTGCAATCATTGGGTTAAAGG - Intergenic
971705815 4:30041390-30041412 AAATGAGGTCATAGGGATAAGGG - Intergenic
972168440 4:36315441-36315463 CAATGACAGCATAGGCATAATGG - Intronic
973275906 4:48308117-48308139 GAATGACATCATTGGATAATTGG + Intergenic
975201364 4:71593752-71593774 GAATGATATCATAAAGATAAAGG - Intergenic
977743074 4:100510618-100510640 GAATTACCTCATAGGGATATTGG - Intronic
979157259 4:117412026-117412048 CAATGACCTCACAGGGCTAAAGG - Intergenic
979702710 4:123686428-123686450 GAAGGACATGATATGATTAATGG - Intergenic
981019977 4:140016009-140016031 GAATGACATGATTGTGTAAATGG + Intronic
981408693 4:144402147-144402169 AAATGAAATCCTAGAGTTAAGGG + Intergenic
982674180 4:158356810-158356832 GGAGGAAATCATAGGGATAAGGG + Intronic
983187629 4:164718555-164718577 GAATGACATCACAGAAATAATGG - Intergenic
983778564 4:171640353-171640375 GGATGAAATCATAGGGTTGTGGG - Intergenic
984864457 4:184269974-184269996 GAAGGACCTCACAGGGTCAAAGG - Intergenic
986192147 5:5507551-5507573 GAATGACATCACTGGGTCATAGG - Intergenic
986509245 5:8485973-8485995 GAAGCACATCATATGTTTAAGGG + Intergenic
988410494 5:30879453-30879475 GAATGATATCAAAGAGATAAAGG - Intergenic
988669652 5:33367442-33367464 AAATGACAACATAGGATTTAGGG - Intergenic
990713928 5:58615212-58615234 GAATGCCACCGTAGGGTTATGGG + Intronic
991428076 5:66512234-66512256 AAATTACTTCATAGGGTTATTGG - Intergenic
996665670 5:126057287-126057309 GATTTACATCATAGGGTCCAGGG + Intergenic
998071996 5:139205239-139205261 CAAAGACATCATAGGGGTGATGG + Intronic
1002203082 5:177542555-177542577 GAATGACTTCATGGGGTTGAGGG - Intronic
1002362127 5:178680825-178680847 GAATCACATTACAGGATTAAAGG - Intergenic
1003815161 6:9831662-9831684 GAAGGAAATCATAGTCTTAATGG + Intronic
1004785685 6:18965096-18965118 GAATCACAGCAGAGGGTGAAAGG + Intergenic
1010337520 6:74704310-74704332 AAAGGACATCAAGGGGTTAAGGG + Intergenic
1013750977 6:113405915-113405937 GAATGCCATCACTGGGTTATGGG - Intergenic
1016473666 6:144402633-144402655 GAATGACAGTATAAGGTTTATGG - Intronic
1017605200 6:156125998-156126020 AAATGACATCATATGGCTTAAGG - Intergenic
1021027527 7:15687098-15687120 GAAAGAAGTAATAGGGTTAAAGG + Intergenic
1021161765 7:17282364-17282386 GAATGACATAATGAGGTTAAGGG - Intergenic
1024356263 7:48416526-48416548 GAACCACAACATAGGGTTGAAGG + Intronic
1025787639 7:64658162-64658184 GAATGACATCAAATAGTTGATGG - Intergenic
1026576420 7:71575332-71575354 GAATGAAAGCATAGGGTTTTGGG - Intronic
1026586631 7:71661000-71661022 CAATGACATCCTAGGGTCAGAGG - Intronic
1027915083 7:84307635-84307657 TAATGACATCATAGTATTATGGG - Intronic
1028462163 7:91106276-91106298 TAATGTCTTCAGAGGGTTAAGGG + Intronic
1033239710 7:139667389-139667411 GAATGAGATCATCAGGTAAAAGG + Intronic
1034041751 7:147885128-147885150 CACTGACCTAATAGGGTTAAAGG + Intronic
1035943894 8:3936993-3937015 GAATGACTTTGTTGGGTTAAAGG + Intronic
1035983972 8:4404905-4404927 GACTGACATCATAGGCTTTTTGG - Intronic
1038470822 8:27817691-27817713 GAATGAAACTATAGGGTCAAAGG + Intronic
1038688697 8:29742054-29742076 CAATGACTCCTTAGGGTTAATGG - Intergenic
1038777500 8:30544221-30544243 GAAAGACATCAGAGTGTTCAAGG + Intronic
1038834700 8:31106442-31106464 GAATGAGATCAGAGGGAAAATGG - Intronic
1043220387 8:77655431-77655453 CCATGAAATCATAGAGTTAAAGG - Intergenic
1043283064 8:78493771-78493793 GAATCACATCCTAGGGAGAATGG - Intergenic
1045198948 8:99959474-99959496 GAATGACAACATTGTGATAAGGG + Intergenic
1045415645 8:101964347-101964369 CAATGAAATCAGAGGGTTATTGG - Intronic
1046326648 8:112656975-112656997 GAGCTACACCATAGGGTTAATGG - Intronic
1046564295 8:115878887-115878909 GAATGAAATCAGAGGGTTCTGGG + Intergenic
1048127329 8:131650386-131650408 GAAGAACATCATAGGGATTAGGG - Intergenic
1053345976 9:37378517-37378539 AAATGACTTCATAGGCTGAAGGG - Intergenic
1058189556 9:101896229-101896251 GAATTAGATCAGAGGGGTAAAGG + Intergenic
1186218082 X:7321826-7321848 CAAAGACAGCATAGGGCTAAGGG - Intronic
1186724481 X:12342686-12342708 GTATGACATAATGTGGTTAAAGG + Intronic
1186844610 X:13518306-13518328 GCATGCCATCACACGGTTAAAGG - Intergenic
1187223649 X:17354868-17354890 CATTGACTTCATAGGGTTATTGG - Intergenic
1188808710 X:34624495-34624517 GAATGACTTCATAGAAATAATGG - Intergenic
1190580120 X:51884622-51884644 GACTGACTTCATAGAATTAATGG - Intronic
1193753389 X:85375559-85375581 GAATGAGGTCATAGGATAAAGGG - Intronic
1194490588 X:94542982-94543004 GAATGACAGCATGGGGTTGTTGG + Intergenic
1195179594 X:102344060-102344082 GGAAGACATCATAGAGTGAAAGG - Intergenic
1195765223 X:108289150-108289172 TAAGGACATCATTGGGATAACGG + Intronic
1199444824 X:147910438-147910460 GAATCTCATCATAGGCTGAATGG - Intergenic
1200904656 Y:8469444-8469466 GAGTCACATCATAGGGGTGATGG - Intergenic
1200942085 Y:8794757-8794779 GAATGACATCATAGCCTTTGAGG - Intergenic