ID: 1092937563

View in Genome Browser
Species Human (GRCh38)
Location 12:13378245-13378267
Sequence CTGTCCACACATAGGAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 189}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092937558_1092937563 -8 Left 1092937558 12:13378230-13378252 CCCTACAGCCTATTTCTGTCCAC 0: 1
1: 0
2: 2
3: 14
4: 169
Right 1092937563 12:13378245-13378267 CTGTCCACACATAGGAAGGCAGG 0: 1
1: 0
2: 3
3: 22
4: 189
1092937555_1092937563 2 Left 1092937555 12:13378220-13378242 CCTTAGCCCTCCCTACAGCCTAT 0: 1
1: 0
2: 1
3: 10
4: 189
Right 1092937563 12:13378245-13378267 CTGTCCACACATAGGAAGGCAGG 0: 1
1: 0
2: 3
3: 22
4: 189
1092937556_1092937563 -4 Left 1092937556 12:13378226-13378248 CCCTCCCTACAGCCTATTTCTGT 0: 1
1: 0
2: 2
3: 17
4: 310
Right 1092937563 12:13378245-13378267 CTGTCCACACATAGGAAGGCAGG 0: 1
1: 0
2: 3
3: 22
4: 189
1092937553_1092937563 7 Left 1092937553 12:13378215-13378237 CCCAGCCTTAGCCCTCCCTACAG 0: 1
1: 0
2: 1
3: 10
4: 183
Right 1092937563 12:13378245-13378267 CTGTCCACACATAGGAAGGCAGG 0: 1
1: 0
2: 3
3: 22
4: 189
1092937557_1092937563 -5 Left 1092937557 12:13378227-13378249 CCTCCCTACAGCCTATTTCTGTC 0: 1
1: 0
2: 2
3: 12
4: 213
Right 1092937563 12:13378245-13378267 CTGTCCACACATAGGAAGGCAGG 0: 1
1: 0
2: 3
3: 22
4: 189
1092937559_1092937563 -9 Left 1092937559 12:13378231-13378253 CCTACAGCCTATTTCTGTCCACA 0: 1
1: 0
2: 3
3: 65
4: 302
Right 1092937563 12:13378245-13378267 CTGTCCACACATAGGAAGGCAGG 0: 1
1: 0
2: 3
3: 22
4: 189
1092937554_1092937563 6 Left 1092937554 12:13378216-13378238 CCAGCCTTAGCCCTCCCTACAGC 0: 1
1: 0
2: 2
3: 23
4: 527
Right 1092937563 12:13378245-13378267 CTGTCCACACATAGGAAGGCAGG 0: 1
1: 0
2: 3
3: 22
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092937563 Original CRISPR CTGTCCACACATAGGAAGGC AGG Intronic
900752340 1:4406481-4406503 CTGTGCACCCATAGGTGGGCTGG + Intergenic
902234919 1:15051090-15051112 CTGAGCAGACATCGGAAGGCTGG - Intronic
903231607 1:21925732-21925754 GTGTCCAGACAGAGGAAGTCTGG - Intronic
903516168 1:23912434-23912456 CAGTCCACACCTCGTAAGGCAGG + Intronic
904605267 1:31694721-31694743 CTGGACCCCCATAGGAAGGCTGG + Intronic
904702493 1:32366193-32366215 CTGTCCATACATAAGCAGGCAGG - Intronic
908409466 1:63848309-63848331 CTCTCCACACAAAGAAAGACTGG - Intronic
908560765 1:65303873-65303895 CTGACCACACTTAGTAAGGCAGG + Intronic
918008315 1:180562717-180562739 GTGTGCACAGAGAGGAAGGCTGG + Intergenic
919349293 1:196428859-196428881 CTGCCCACACATGGGCAGCCAGG + Intronic
920203921 1:204277728-204277750 CTGTCCACACAGAAGAAGGCTGG - Intronic
921482493 1:215679067-215679089 CTGTCCACATGTAGGCAGGCTGG + Intronic
922430576 1:225548614-225548636 CTGTCCATACCTAGAAAGGGAGG - Intronic
923996050 1:239495601-239495623 CTGTTCAAAGAGAGGAAGGCTGG - Intronic
924676121 1:246179778-246179800 CTATCAACACATAGAAAGCCTGG - Intronic
1063377875 10:5564874-5564896 CTGACCCCACAGAGTAAGGCTGG + Intergenic
1065820304 10:29519010-29519032 CTGTCCCCACTAAGGAGGGCAGG - Intronic
1066080663 10:31928355-31928377 CTGCCCTCACACAGGAAGTCAGG + Intronic
1068644841 10:59454627-59454649 CTGTACAAACAAAGGAAAGCAGG - Intergenic
1068860854 10:61846321-61846343 GTGGCCACACATGGCAAGGCTGG - Intergenic
1070747968 10:78946284-78946306 CTCTGCACACTCAGGAAGGCTGG + Intergenic
1070790117 10:79184124-79184146 CTGTCCTCCCACAGGAAGACAGG - Intronic
1070836228 10:79448555-79448577 CTGTCCTCAGACTGGAAGGCAGG + Intergenic
1070955284 10:80459640-80459662 CTGTCAACGCATAGTCAGGCAGG - Intronic
1073299015 10:102459429-102459451 CTGGCCACAGATAGAAAGGCGGG + Intergenic
1073435326 10:103512805-103512827 GTGTCCACACTGAGGGAGGCAGG + Intronic
1074432007 10:113402101-113402123 CTGGCGAGACATAGGAAGACAGG + Intergenic
1077075536 11:699867-699889 CTGTCCACAGTCAGGAGGGCAGG + Intronic
1077232031 11:1462045-1462067 CTCCCCACACACAGGACGGCAGG + Intronic
1078879533 11:15434349-15434371 CTCTCCTCACAGAGGAAAGCAGG - Intergenic
1080011303 11:27462265-27462287 CTGTCCTAACATGGGAACGCAGG - Intronic
1081221753 11:40470982-40471004 CTTTCCAAACCTAGCAAGGCAGG + Intronic
1081242264 11:40721563-40721585 TTGTGGACACATAGGAAGCCTGG + Intronic
1083365729 11:62140537-62140559 CTGCCCACTCAGAGGAAGGGAGG - Intronic
1084464307 11:69313308-69313330 CTGTCCACACTTACAAAGCCAGG - Intronic
1085510261 11:77084555-77084577 CTGGTCAAACAAAGGAAGGCAGG + Intronic
1087666412 11:101053825-101053847 CTGCCCACACAGAGAAAGGAAGG - Intronic
1089748545 11:120634104-120634126 CTGCACACACACTGGAAGGCAGG - Intronic
1090955772 11:131511906-131511928 CTGTCCACACCTGGGATGGCAGG + Intronic
1092576290 12:9786941-9786963 ATGTCCACACATCAGGAGGCAGG - Intergenic
1092937563 12:13378245-13378267 CTGTCCACACATAGGAAGGCAGG + Intronic
1093913437 12:24773594-24773616 ATGTACACATATAGGAGGGCAGG - Intergenic
1099314418 12:81066286-81066308 CTTTCCCAACATAGCAAGGCAGG + Intronic
1099511887 12:83548915-83548937 CTTTCCAAACATAGCAAGGCAGG - Intergenic
1100125517 12:91420048-91420070 CTGACCACACAATGGAAGGTTGG + Intergenic
1102251339 12:111389614-111389636 TTCTCCCCACATTGGAAGGCAGG + Intergenic
1102595813 12:113991874-113991896 TTGTCCACACATTGGTAGGCAGG + Intergenic
1102741814 12:115214028-115214050 GTGTCCACACGTAGGTAGGCAGG + Intergenic
1103717376 12:122952914-122952936 CTGTCCACACAGTAGAAGGCAGG + Intronic
1104749686 12:131230301-131230323 CTGTGTACAGATAGGAAGGCAGG - Intergenic
1104783740 12:131436997-131437019 CTGGGCACAGATAGGAAGGCAGG + Intergenic
1104814383 12:131637478-131637500 TTGTGGACACATGGGAAGGCGGG + Intergenic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1106209997 13:27633237-27633259 TTATACACACATAAGAAGGCAGG + Intronic
1106467270 13:30024146-30024168 CTGTCCAAAGAAAGGAAGGAAGG + Intergenic
1108577168 13:51800491-51800513 CTGCCCACGCACAGGCAGGCTGG + Intronic
1111508994 13:89235652-89235674 CTGTCCACATGAAGGAAGGGAGG - Intergenic
1113782890 13:112986701-112986723 GTGTCCACCCACAGGCAGGCAGG - Intronic
1115532980 14:34343991-34344013 CTTTCCACAGCTAGGAAGACCGG + Intronic
1116568714 14:46487340-46487362 CTGTCCACTCAGAGGCAGGCTGG - Intergenic
1120125920 14:80743111-80743133 CTTTCAACAGATAGAAAGGCAGG - Exonic
1123467441 15:20527332-20527354 CAGTCCACAAATATGTAGGCAGG - Intergenic
1123650673 15:22473710-22473732 CAGTCCACAAATATGTAGGCAGG + Intergenic
1123741081 15:23282552-23282574 CAGTCCACAAATATGTAGGCAGG + Intergenic
1123745917 15:23320006-23320028 CAGTCCACAAATATGTAGGCAGG - Intergenic
1124081647 15:26504276-26504298 CTGTCAAAACAGTGGAAGGCAGG - Intergenic
1124278188 15:28343323-28343345 CAGTCCACAAATATGTAGGCAGG - Intergenic
1124304513 15:28568285-28568307 CAGTCCACAAATATGTAGGCAGG + Intergenic
1125339442 15:38660449-38660471 CTGACCACACGTAGGAATGCTGG - Intergenic
1129437001 15:75549720-75549742 CTGTCTAGACCTTGGAAGGCTGG + Intronic
1129702575 15:77776150-77776172 CTGTCCCCATAAAGGGAGGCAGG - Intronic
1130225615 15:82056293-82056315 CTGGCCACACAGAGAGAGGCGGG + Intergenic
1130284871 15:82546601-82546623 TTGGCCACACACAGGAATGCGGG + Intronic
1130329253 15:82908082-82908104 CTGTCCAAGCACAGGAAGCCAGG + Intronic
1131462106 15:92624739-92624761 CTTTCCACACATAAGAAGCCGGG + Intronic
1132076820 15:98828387-98828409 CTGTCCATCCATAGGATGGTTGG + Intronic
1132573018 16:652206-652228 CTGTCCACAAAGAGTAAGGCAGG + Intronic
1133300160 16:4777620-4777642 CTATCCACAAATAAAAAGGCTGG - Intergenic
1134069589 16:11252647-11252669 CAGTCCCTACATCGGAAGGCTGG + Intronic
1135201204 16:20439124-20439146 CTGTTAACAGATAGGAATGCTGG + Intronic
1135217904 16:20588740-20588762 CTGTTAACAGATAGGAATGCTGG - Intergenic
1135956271 16:26958959-26958981 CTGACCACACAGATGAAGCCAGG - Intergenic
1135985487 16:27180788-27180810 CTGTCCTCACATAGCAAGAGAGG - Intergenic
1137715545 16:50596087-50596109 CTGTACATGCATAGGAAGCCAGG - Intronic
1137955790 16:52827697-52827719 ATGTCCACACAAAGGATGGGAGG - Intergenic
1138423399 16:56914554-56914576 TTGTCCACACACAGGGAGTCTGG + Exonic
1138465175 16:57185240-57185262 CAGTCCACACAGAGGAAAGGGGG - Intronic
1138782152 16:59801731-59801753 CTGTCAAGACATTGAAAGGCAGG - Intergenic
1139233808 16:65313377-65313399 CTGGCCACACAATGGAAGACCGG - Intergenic
1139485757 16:67255749-67255771 CTGACCACAAACAGGGAGGCTGG - Exonic
1143689951 17:8552952-8552974 CTGTCAACCCATAGGAACTCCGG - Intronic
1146545452 17:33734245-33734267 CTGGCCACACACAGGAACACAGG - Intronic
1146679149 17:34794665-34794687 GTGTCCACACATGGAAAGGCTGG + Intergenic
1147399959 17:40174769-40174791 CTGCCCACCCAGAGGCAGGCTGG - Intergenic
1147940215 17:44041481-44041503 CTGTGCTCACATAGGGAGCCAGG + Intronic
1149294357 17:55248344-55248366 CTGTCCAGAGATAGGCAGCCTGG - Intergenic
1150426097 17:65078292-65078314 ATGTCAACACGTTGGAAGGCAGG - Intergenic
1151507438 17:74538964-74538986 CTGTCCACACTCAGAATGGCTGG + Intergenic
1152465757 17:80465176-80465198 CTGTCCCAACACAGGAAGACGGG - Intergenic
1153046171 18:857314-857336 CTGTGGACACACAGGAATGCTGG + Intergenic
1153747762 18:8198016-8198038 GTGTCCACACAGAAGAAGGTGGG - Intronic
1155158481 18:23177484-23177506 CTGACCACACATAGACCGGCGGG - Intronic
1155273179 18:24160645-24160667 CTGTCCACACATAGGGGAGGAGG - Intronic
1156890769 18:42187180-42187202 CTGTGCACACACATGAAGCCTGG + Intergenic
1157212297 18:45754084-45754106 GTGTCCACACTGAGGAAGGGAGG + Intergenic
1160513953 18:79468300-79468322 CTGTACCCACAAAGGAAGCCGGG - Intronic
1162883254 19:13676405-13676427 CTGTCCAAAGAAAGGAAGGAAGG + Intergenic
1165771607 19:38383711-38383733 CTGTGGACACATAGGAATGCTGG + Exonic
927714587 2:25343244-25343266 CTGCCCACAAGTAGGATGGCGGG - Intergenic
929881499 2:45840930-45840952 CTGTCCCCAGGAAGGAAGGCAGG - Intronic
930675097 2:54191900-54191922 CTGTCCACCCACAGGAATGTGGG + Intronic
932734264 2:74243308-74243330 GTGGCCACCCATAGGAAGTCAGG + Intronic
933306647 2:80608688-80608710 CAATCCACACATAGAGAGGCTGG - Intronic
933373287 2:81445273-81445295 CTTTCCAAACAGTGGAAGGCAGG - Intergenic
935452612 2:103227516-103227538 CAGGCCTCACATAGGAAGCCTGG - Intergenic
937961947 2:127466715-127466737 CTGTGCACTCAGAAGAAGGCTGG + Intronic
938318579 2:130346625-130346647 CTGACCACTCAGAGGCAGGCGGG - Intronic
940036134 2:149313787-149313809 CTGGCATCACATAGGAAGCCTGG + Intergenic
940855008 2:158723039-158723061 CTCTCCACACCTGGGCAGGCAGG - Intergenic
942261789 2:174172401-174172423 TTGCCCACATATAGGAAGGTGGG - Intronic
942484755 2:176427142-176427164 CTGTGCATTCACAGGAAGGCGGG + Intergenic
942497909 2:176558997-176559019 CTGACCACACAGAGAACGGCAGG - Intergenic
942539014 2:176995986-176996008 CAGCACACAGATAGGAAGGCTGG - Intergenic
944059533 2:195557703-195557725 CTTTACACACTGAGGAAGGCAGG + Intergenic
946180401 2:217945644-217945666 CTGTCCACAAATGGCAAGGATGG + Intronic
946203898 2:218089664-218089686 CTGTGCTCACAGAGGAAGGAGGG - Intronic
946872873 2:224100672-224100694 CTGTCCTCACATTGGAGGGAGGG - Intergenic
947606671 2:231490529-231490551 CTGCCCACAGATAGGGAGCCAGG + Intergenic
948249012 2:236510440-236510462 CTGTCAGCACAGAAGAAGGCAGG + Intergenic
948308577 2:236968530-236968552 CTGTCCACCCGAAGCAAGGCTGG + Intergenic
1168779160 20:473951-473973 CTGTCAACAAAGAGGAAGGGAGG + Intronic
1168914101 20:1472248-1472270 CTGACCACAGATAGAAAGGGTGG - Intronic
1171257486 20:23701161-23701183 CAGTCTATACATAGGAAGGGTGG - Intergenic
1171264900 20:23763320-23763342 CAGTCTATACATAGGAAGGGTGG - Intergenic
1172837981 20:37885199-37885221 CAGGTCACACACAGGAAGGCTGG - Intergenic
1173211273 20:41034427-41034449 CTGTCCACATCTAGATAGGCAGG - Intronic
1173380629 20:42536506-42536528 ATGTTCACACACAGGAATGCAGG - Intronic
1175772789 20:61634247-61634269 CTGTCCACACACAGGAAGGAGGG - Intronic
1175988111 20:62774354-62774376 TTGTGCACACAAAGGAAGGAGGG - Intergenic
1179103580 21:38378196-38378218 TTGTCCATACATAGAAAGTCAGG - Intergenic
1179802877 21:43819743-43819765 CTGGGCCCACACAGGAAGGCCGG - Intergenic
1180597497 22:16988290-16988312 CTGTCCTCCCAGAGGAGGGCTGG + Intronic
1181762061 22:25065424-25065446 CCGTCCCCACATAGGAATGCGGG + Intronic
1181971475 22:26693671-26693693 CTGTCCACAGATAGCAGGGCTGG + Intergenic
1183379185 22:37482318-37482340 CTGGCCACACTTAGGGAGGCTGG - Intronic
1183477314 22:38042736-38042758 CTGACCACACAGAAGAGGGCTGG + Intergenic
1183617147 22:38952857-38952879 ATTTCTACACATAGGAAGGGTGG + Intronic
1184022551 22:41830609-41830631 TTGTTCACACACAGGGAGGCTGG - Intergenic
1184475095 22:44716040-44716062 CTGTTCACACCAAGGAGGGCAGG - Intronic
1184486551 22:44783328-44783350 CTGTCCACACAGAGGCAGGCGGG + Intronic
953420778 3:42751669-42751691 CTGTCTCCAGAAAGGAAGGCTGG - Intronic
954402339 3:50325535-50325557 CTGTCCATCCATCTGAAGGCGGG + Exonic
955570131 3:60295830-60295852 CTGGGCATACATAGGAAGGAGGG + Intronic
956696287 3:71921897-71921919 CTGAATACACATAGGAAGGTGGG - Intergenic
956742679 3:72287365-72287387 CTGTCCAGAGATAGGGAGGCTGG + Intergenic
956862577 3:73339259-73339281 CTGTTCAAACACAAGAAGGCAGG - Intergenic
958100939 3:89009277-89009299 CTGTTCACTAATAGGAAGACAGG - Intergenic
960595499 3:119404354-119404376 TTGGCCACAGGTAGGAAGGCAGG - Intronic
961778449 3:129306929-129306951 CTGGCCACACCTAGACAGGCAGG - Intergenic
963306137 3:143655292-143655314 CTGCCCACACCTTGCAAGGCTGG + Intronic
964378309 3:156071307-156071329 CTTTCCACAGACAGGAAGGGGGG - Intronic
965453888 3:168873632-168873654 CTATCCACACATTGGGAGGATGG + Intergenic
966068574 3:175846696-175846718 CAGTCCACATATTGCAAGGCTGG + Intergenic
967364142 3:188666712-188666734 TTGTCCACACACTGGAAGTCAGG + Intronic
969127701 4:4965304-4965326 CAGTCCATTCATAGGAAAGCAGG - Intergenic
970492078 4:16584937-16584959 CTGACCCCACATAGGAAGCTGGG - Intronic
971069298 4:23072730-23072752 GTGTCCACACAAAGGTAAGCAGG + Intergenic
972329944 4:38055574-38055596 GTGCCCCCACATAGAAAGGCTGG - Intronic
976760210 4:88540543-88540565 CTTCCCTCACCTAGGAAGGCAGG + Intronic
979284742 4:118909639-118909661 CTGCCCACGCTTGGGAAGGCTGG + Intronic
981693100 4:147531392-147531414 CTGTGCTCACATAAGAAGGGAGG + Intronic
984230831 4:177096810-177096832 ATGTACAGACATATGAAGGCAGG - Intergenic
992472152 5:77068732-77068754 CTGTGCACATCTTGGAAGGCAGG + Intergenic
992638631 5:78749521-78749543 GTGACCAAACATAGGAAGGTGGG - Intronic
994922594 5:106068365-106068387 CTGACAAAACATAGGAATGCAGG + Intergenic
996422801 5:123280662-123280684 CTGTCCTCACTCAGGAATGCAGG - Intergenic
997476241 5:134144221-134144243 CTGTCCCCACACAGGGAAGCTGG + Intronic
999262126 5:150244766-150244788 CAGCCCACACATAGGCAGGACGG + Intronic
1000596646 5:163221962-163221984 GTGTCCACCCAGAGGAAGACAGG + Intergenic
1001255635 5:170181398-170181420 ATGTCCACACATAGGAGAGAAGG + Intergenic
1002191902 5:177482727-177482749 CCGTCCAAACAGAAGAAGGCAGG - Intergenic
1002562867 5:180094098-180094120 TTGTCCATAAATAGGAAGCCAGG - Intergenic
1009386883 6:63095739-63095761 TTGTACACACATAGGATGACTGG - Intergenic
1010105003 6:72157046-72157068 CTGTCCGTACTTAGGAATGCTGG + Intronic
1016023006 6:139255502-139255524 CTGTCCCCAGATAAAAAGGCTGG - Intronic
1017563780 6:155662562-155662584 CTGTCTACACATAGTCATGCAGG + Intergenic
1020055736 7:5116760-5116782 TCGTCCATACCTAGGAAGGCAGG - Intergenic
1024523769 7:50330612-50330634 CTGTCACCACATATGAAAGCTGG - Intronic
1030866842 7:114710565-114710587 CTGCCCACACAAAGGCAGGTGGG - Intergenic
1038308680 8:26427982-26428004 GTGTGCACACATAAGAAGGAGGG + Intronic
1040660975 8:49575062-49575084 CAGTCCACACATAGGGAGAGGGG - Intergenic
1047868692 8:129058179-129058201 CAGAACACACATAGGATGGCAGG + Intergenic
1048082178 8:131140200-131140222 CTATCTAAACATAAGAAGGCAGG - Intergenic
1049345988 8:142138901-142138923 CCGTCCACACAGAGGGAGACGGG + Intergenic
1049494290 8:142922494-142922516 CTGTCCTCCCAAGGGAAGGCGGG - Intergenic
1051308967 9:15748420-15748442 CTTCCCAAACATAGCAAGGCAGG + Intronic
1055490978 9:76805112-76805134 CTGTTCCCACATAAGAAGCCTGG + Intronic
1055943662 9:81673669-81673691 GTATCCACACAAAGGGAGGCTGG + Intronic
1056431204 9:86529647-86529669 TTGTCCAGACAGATGAAGGCAGG + Intergenic
1056825638 9:89874624-89874646 CTGTCCACACATAGGGACACAGG + Intergenic
1057041141 9:91848357-91848379 CTGTCCACCCATCTGGAGGCAGG + Intronic
1057515636 9:95718079-95718101 CTGACCACACATAAGATGGAGGG + Intergenic
1057742707 9:97726106-97726128 CTGTCCGCACACAGGAGAGCTGG - Intergenic
1061355397 9:130100854-130100876 CTGTCCAGACTTGGGAAGTCGGG + Intronic
1062325313 9:136009960-136009982 CTGGCCACACCTGGGAAGGAGGG + Exonic
1203786179 EBV:129138-129160 CTGTCCACGCATTTGTAGGCGGG + Intergenic
1186417269 X:9394614-9394636 CTGGCCATACAGAGGAAAGCAGG + Intergenic
1190399235 X:50014913-50014935 CTGTCCACACACAGGGTGGTGGG + Intronic
1191119883 X:56892222-56892244 CTTTCCCAACATAGCAAGGCAGG + Intergenic
1192348706 X:70336247-70336269 ATGTGCATACATAGGAAGGGGGG - Intronic
1197802229 X:130363207-130363229 TTGTCCACAGCTAGGAGGGCTGG - Intronic
1198039568 X:132836435-132836457 GTGCCCACAAATGGGAAGGCTGG + Intronic
1198831208 X:140752481-140752503 CTGTTCACACAGAGAAAGCCAGG - Intergenic
1199471330 X:148199052-148199074 TTGTCCACTCAGAGGAAGCCTGG + Intergenic
1201378357 Y:13345701-13345723 CTGTCCACTCATAGTAGGTCTGG - Intronic