ID: 1092938144

View in Genome Browser
Species Human (GRCh38)
Location 12:13383137-13383159
Sequence ATGGTGAGAGAAATCTGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 2, 1: 0, 2: 15, 3: 76, 4: 336}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092938143_1092938144 -6 Left 1092938143 12:13383120-13383142 CCTTTGCAAAGATTGTGATGGTG 0: 1
1: 1
2: 7
3: 85
4: 343
Right 1092938144 12:13383137-13383159 ATGGTGAGAGAAATCTGACATGG 0: 2
1: 0
2: 15
3: 76
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092938144 Original CRISPR ATGGTGAGAGAAATCTGACA TGG Intronic
902738896 1:18420606-18420628 GCAGTGAGAGAAATCTGACATGG - Intergenic
903552187 1:24165559-24165581 ATGGAGAGGGCAATGTGACAAGG + Intronic
903699083 1:25232800-25232822 ACAGTGAGAGAAATCTAACATGG + Intergenic
903789894 1:25885729-25885751 ATGGTGAGAGAGATCAGACCAGG + Exonic
906454455 1:45981747-45981769 ACAGTGAGAAAAATCTGACTAGG - Intronic
908111570 1:60903654-60903676 ATGGTGAGAGACATCTGCCCAGG - Intronic
908896761 1:68909879-68909901 ATGTTGAGAGAAGTTTGACTAGG + Intergenic
910515783 1:88058523-88058545 ATGGTCAGTGACATCTGCCAAGG - Intergenic
911440949 1:97925079-97925101 ATGGTGAGAGGAAACCAACAAGG - Intergenic
912053169 1:105558034-105558056 ATTGTGGGAGAAATCTTAAATGG - Intergenic
912638803 1:111323858-111323880 CTGCTGAGAGAAGTCTGCCATGG - Intergenic
913378595 1:118184635-118184657 ATGCTGAGTGAAAACAGACACGG - Intronic
914005971 1:143732523-143732545 ACAATCAGAGAAATCTGACATGG - Intergenic
914080483 1:144406125-144406147 ATGATAAGAGAAATTTGAGAAGG + Intergenic
914098440 1:144563756-144563778 ACAATCAGAGAAATCTGACATGG - Intergenic
914300542 1:146373886-146373908 ACAATCAGAGAAATCTGACATGG + Intergenic
914382988 1:147136188-147136210 TTGGTGAGAGAAATCAAAGAAGG - Intergenic
914518144 1:148391546-148391568 ACAATCAGAGAAATCTGACATGG - Intergenic
914837042 1:151215830-151215852 ATGGTGCTAGGAATCTGACCAGG + Intronic
915172402 1:153987029-153987051 TTGGTCAGAGAAATCACACATGG - Intergenic
915731801 1:158059205-158059227 CTGCAGAGAGAAATCTGACAGGG - Intronic
916636956 1:166681891-166681913 ATAGTGACTGAAATCTGGCACGG + Intergenic
917472035 1:175334185-175334207 ACAGTGAGAGAAATCTAACATGG + Intronic
917899880 1:179531503-179531525 ATGGTAAGATAAATCTGATGGGG - Intronic
918641272 1:186843993-186844015 ATGGAGAGGGAAATCTTAAAAGG + Intronic
919440943 1:197633082-197633104 AGGGTGAGAGAAATATGGAATGG + Intronic
919819552 1:201464530-201464552 AAGGCGAGAGAAATCTGAACGGG + Intergenic
919866815 1:201788763-201788785 ATGGGGAGAAAAAACTGAAATGG - Intronic
920110978 1:203586807-203586829 ATAGTGAGACAGATCAGACAAGG - Intergenic
920328228 1:205184047-205184069 ATGCTGAGAGAAAGCTGATTTGG + Intronic
920628340 1:207626169-207626191 AGAGTGAAAGAAATCTAACATGG - Intronic
920693767 1:208166033-208166055 AAGGAGAGAGAACTCTGAAAAGG + Intronic
921195236 1:212750214-212750236 AGGGTGAGATCAATCTAACAAGG + Intronic
921235366 1:213121615-213121637 CAGGTGAGAGAAATATGTCAAGG - Intronic
921421108 1:214949431-214949453 AGGATGAGGGAAATCTGAGAAGG + Intergenic
921691784 1:218159661-218159683 ATTGTGAGAGAATTCGGGCAGGG - Intergenic
922031082 1:221799475-221799497 CTGGTGAGAGAATTGTGAGAGGG - Intergenic
922466164 1:225846626-225846648 ATGGAGAGAGAGATGTAACAAGG - Exonic
923596830 1:235366944-235366966 ACAGTAAGAGAAATCTGACATGG - Intergenic
923704941 1:236336449-236336471 ATGGTTAGAGCTATCTGGCAGGG + Intergenic
923928225 1:238660229-238660251 ATGGTGAGGGTAATATGTCAAGG + Intergenic
924807766 1:247374765-247374787 ACAGTCAGAGAAACCTGACATGG + Intergenic
1064936378 10:20683267-20683289 ATGGTGGGAGATATCAGAGAAGG + Intergenic
1066075499 10:31871517-31871539 ATGGTGACAGATCTGTGACAGGG - Intronic
1068391996 10:56409505-56409527 ATTGAGAGGGAAATCTAACAAGG + Intergenic
1068527172 10:58143598-58143620 ACAGTGAGAGAAATTTGACATGG + Intergenic
1069806449 10:71128132-71128154 ACAGTAAGAAAAATCTGACATGG + Intergenic
1070235880 10:74625680-74625702 ATAGTGAGACAAATGTGATAGGG + Intronic
1070601429 10:77869012-77869034 ATCCTGTGAGTAATCTGACAAGG + Intronic
1071723099 10:88167077-88167099 AATCTGAGAGAAATCTGACATGG - Intergenic
1072275751 10:93821036-93821058 ACAGTAAGAGAAATCTGATATGG - Intergenic
1073837646 10:107463347-107463369 GTGGTTATAGAAATCTGACCAGG - Intergenic
1075143642 10:119864261-119864283 CTGGAGACAGAAGTCTGACATGG - Intronic
1075243519 10:120799622-120799644 ATAGAAAGAAAAATCTGACATGG + Intergenic
1075462454 10:122626247-122626269 ATGGTGAAATAAAAATGACATGG - Intronic
1076551295 10:131279637-131279659 AAGGAGAGAGAAAGCTGAGAAGG + Intronic
1078576545 11:12507622-12507644 ATGGTCAGAGAAACCTTCCAAGG - Intronic
1078822559 11:14896402-14896424 ATGGTGAGCAAAATCAGCCATGG + Intergenic
1080013527 11:27481657-27481679 ATTTTGAAAGAAATCTGAAATGG + Intergenic
1080219237 11:29881097-29881119 ACGGTGAGAGAAATATGACATGG + Intergenic
1083539101 11:63499451-63499473 ATGGTGAGAAAATTATGACAGGG + Intergenic
1084046325 11:66569958-66569980 ACAGTAAGAGAAATCTGACATGG + Intergenic
1085076874 11:73598815-73598837 CTGGTGAGAGACAGCTGAAACGG - Intergenic
1085621635 11:78042096-78042118 ACAGTGAGAGGAATCTGACATGG + Intronic
1086407531 11:86511448-86511470 ACAGTGAGAGAAATCTAGCATGG + Intronic
1086701698 11:89906397-89906419 ATGTTAAGAGAAATATCACAGGG + Intergenic
1086704470 11:89938128-89938150 ATGTTAAGAGAAATATCACAGGG - Intergenic
1087340637 11:96901645-96901667 ATAGAGATAGAAAACTGACAGGG + Intergenic
1089039419 11:115432291-115432313 ATGGTGAGCGAAAGCAGACTTGG - Intronic
1089252686 11:117176491-117176513 CAGCTGAGAGAACTCTGACAAGG + Intronic
1089275453 11:117332605-117332627 ATATTGAGAGAAATCTGTCTGGG + Intronic
1089956649 11:122577344-122577366 ACAGTGAGAGAAATCTGACATGG - Intergenic
1090049444 11:123364499-123364521 ATGGTGAGAGAAAATGCACACGG - Intergenic
1090844304 11:130518100-130518122 ACAGTGAGAAAAATCTAACATGG + Intergenic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1092938144 12:13383137-13383159 ATGGTGAGAGAAATCTGACATGG + Intronic
1094292361 12:28866295-28866317 ATGTTGAGAGGATTTTGACAAGG + Intergenic
1096287536 12:50313448-50313470 AGGGTGAGACAACTCTGACAGGG - Intergenic
1097978899 12:65717075-65717097 ACAGTAAGAGAAATCTGACATGG + Intergenic
1099000101 12:77169464-77169486 ATTTTTAGAGAAATCTGACATGG - Intergenic
1100688030 12:97008005-97008027 AAGTTGAGAGAGATCTGCCAAGG - Intergenic
1101917054 12:108903916-108903938 AAGATGAGAGGACTCTGACAAGG + Intergenic
1105811793 13:24001913-24001935 ATGGTGAGATAAAGGGGACATGG + Intronic
1106392994 13:29353860-29353882 ATGGGGACAGAACTCTGCCAAGG - Intronic
1107427384 13:40307455-40307477 ACAGTGAGAGAAATCTGGCATGG - Intergenic
1108352926 13:49603536-49603558 ACAGTAAAAGAAATCTGACATGG - Intergenic
1108842037 13:54630261-54630283 CTTGTGAGAGAAATCTTACAAGG - Intergenic
1108845968 13:54678800-54678822 ACACTAAGAGAAATCTGACATGG + Intergenic
1109245616 13:59951228-59951250 ATAGTGAGTGAATTCTCACAAGG + Intronic
1109909870 13:68895318-68895340 ACAGTGAGAGAAATCTAACATGG + Intergenic
1110380751 13:74847898-74847920 ACAGTGAGAGAAGTCTGGCATGG + Intergenic
1110847663 13:80208044-80208066 ATGGTGAGAGAAATTTGAGGTGG + Intergenic
1111794064 13:92895439-92895461 ATGGAGAGAGAAAATTGCCAAGG + Intergenic
1111866640 13:93776972-93776994 ATGGATAAGGAAATCTGACAGGG - Intronic
1112672856 13:101660752-101660774 AAAGTAAGAGAAATCTGACATGG - Intronic
1113333495 13:109355363-109355385 ATGTTGATAGAAAACTGACAGGG + Intergenic
1114361327 14:21976375-21976397 CTGCTGAGAGAAATCAGAGATGG - Intergenic
1114734857 14:25033810-25033832 ATGGTGAGCAAAATCAGACAAGG - Intronic
1114810467 14:25892967-25892989 ACAGTAAGAGATATCTGACATGG - Intergenic
1114867816 14:26619439-26619461 ATGATGAAAAAAATCTGCCAGGG + Intergenic
1115084896 14:29502761-29502783 ATGGTCAGATAAATCTCAAAAGG + Intergenic
1115122164 14:29950821-29950843 ATGTTGAGAGAAAGCCCACAGGG + Intronic
1115315026 14:32016335-32016357 AGGGTGATAGAAATCTAAAATGG + Intronic
1115501397 14:34053093-34053115 ATGGTGAGAAAAATCAGAAATGG - Intronic
1115801305 14:36996965-36996987 AGGGTAAGAGAAGGCTGACAGGG + Intronic
1116056475 14:39870591-39870613 ATGCTGAGAGAAGTGGGACAGGG + Intergenic
1116090427 14:40297005-40297027 ATGATGTGAACAATCTGACAGGG - Intergenic
1116690921 14:48104386-48104408 ACGGTGAGAGAAATCTGATGTGG - Intergenic
1117445520 14:55800445-55800467 ATGGTGAGAGAAATCTGACATGG + Intergenic
1118770359 14:68938860-68938882 CTGATGAGAGAACTCTGAGACGG + Intronic
1118886152 14:69867747-69867769 ACAGTAAGAGAAATCTGACATGG + Intronic
1119064017 14:71507811-71507833 CTGGTAAGAGAAGGCTGACAGGG - Intronic
1119249166 14:73137116-73137138 ACGGTGAGAAGAATCTGAGAGGG - Intronic
1119752862 14:77092720-77092742 ACGGTAAGAGAAGTCTAACATGG - Intergenic
1120304317 14:82748340-82748362 ATTGTGAGAGACTTCTGAGAAGG - Intergenic
1121024133 14:90601933-90601955 ATGGTGAGAGGAACCTGGCAGGG + Intronic
1121155885 14:91683549-91683571 ATTTTGAGACAAATCAGACATGG + Intronic
1123157251 14:106240017-106240039 ATGGTGAGTAAAAGCTCACACGG - Intergenic
1123178519 14:106444709-106444731 ATGGTGAGAGGAAAATGACTGGG - Intergenic
1126033707 15:44527028-44527050 ATGGTGATATAAATCTGATGAGG - Exonic
1126275111 15:46868804-46868826 ATGCCGAGAGACATCTGAGAAGG - Intergenic
1127042072 15:54988104-54988126 ACAGTGAGAGAAATCTCACATGG - Intergenic
1128667785 15:69551212-69551234 ACAATGAGAAAAATCTGACATGG + Intergenic
1128802637 15:70506454-70506476 ACAGTGAGAGAAACCTGACAGGG + Intergenic
1129109285 15:73328296-73328318 ATGGGGAGAGAAGTCTGGCCAGG + Intronic
1129826806 15:78639887-78639909 ATGGTGAAAGAAATGGCACAGGG + Intronic
1129880130 15:79000992-79001014 ATGGTGAGAGAGAGCTCCCAGGG - Intronic
1130032182 15:80326238-80326260 AAAGCCAGAGAAATCTGACAGGG - Intergenic
1131708079 15:95020433-95020455 ATTCTGAGAGAAAAGTGACAGGG + Intergenic
1132532869 16:462182-462204 ATGGTGACAGAAATCAGCAATGG - Intronic
1133081419 16:3323727-3323749 CTGGTGGCAGAAATGTGACAAGG - Intergenic
1135049011 16:19177419-19177441 ACGGTAAGAGAAATCTGTAAAGG + Intronic
1135740759 16:24973403-24973425 ATGGTGAGAGAAGACTAATATGG - Intronic
1136615550 16:31396130-31396152 ATGGTGACAGAAGTCTGACCAGG - Intronic
1137741302 16:50778365-50778387 ATGGTGAGAAAAAATAGACATGG + Intronic
1137993160 16:53180450-53180472 CAGGGGAGAGAAATATGACAAGG + Intronic
1138299797 16:55916498-55916520 ATAATAAGATAAATCTGACATGG - Intronic
1138860510 16:60750251-60750273 ACAGTAAGAGAAATCTGACATGG - Intergenic
1139106305 16:63830873-63830895 ACAGTGAGAGAAATCTACCATGG + Intergenic
1139172211 16:64645930-64645952 ATTATGGGAGAAAACTGACATGG + Intergenic
1141248826 16:82336407-82336429 ACACTGAGAGAAATCTGACATGG + Intergenic
1141326260 16:83062246-83062268 ACTGTGATAGAAAACTGACAGGG - Intronic
1142027328 16:87821546-87821568 ACAGGAAGAGAAATCTGACATGG - Intergenic
1142475880 17:189635-189657 ATGATGAGAGAGTTCTGAAATGG + Intergenic
1143007884 17:3848728-3848750 ATGCTGAGATGAATTTGACAAGG + Intergenic
1143312019 17:5999956-5999978 ATGTTGAAAGAAATGTGAGAAGG + Intronic
1143631271 17:8141785-8141807 ATGGTGAGAGAAGCCTGGGACGG - Exonic
1143813725 17:9493798-9493820 CAGGAGAGAGAAATTTGACAGGG - Intronic
1146146951 17:30427208-30427230 ACAGTAAAAGAAATCTGACATGG - Intronic
1146497459 17:33335969-33335991 AGGGTGAGAGAAATCAAGCATGG - Intronic
1147439189 17:40437120-40437142 GTGGTGACAGAACTCTCACAGGG + Intergenic
1148627203 17:49078747-49078769 ACAGTGTGAGAAATCTGACGTGG + Intergenic
1148642382 17:49197798-49197820 ACAGTGAGAGAAATCTGACATGG - Intergenic
1148715503 17:49712840-49712862 AGGGTGAGACAGATATGACAAGG - Intronic
1149727794 17:58914120-58914142 ACAGTGAGAAAAATTTGACATGG - Intronic
1151099022 17:71534147-71534169 CTGATGAGAGAAATCTGGAAGGG + Intergenic
1158023212 18:52868491-52868513 ACAGTAAGAGAAATTTGACATGG + Intronic
1159979508 18:74760356-74760378 ATGAAGGGAGAAATCTGAAAAGG - Intronic
1160327493 18:77964580-77964602 TTGGTGAAAGAAACCAGACAGGG + Intergenic
1161636690 19:5393644-5393666 AGGCTGAGAGACATCTGAAAAGG - Intergenic
1162317333 19:9947531-9947553 ATGGTGAGAGGAAAGGGACAGGG + Intergenic
1162648952 19:12070514-12070536 ATCAGGAGAGAAATCTGACCTGG + Intronic
1163862962 19:19751859-19751881 GTGGTGCGAGAAAGGTGACATGG + Intergenic
1164492982 19:28731266-28731288 ATGGTGAGAGACATCTAAACTGG - Intergenic
1166691113 19:44821539-44821561 ATGGAGAAAGAAATGAGACAGGG + Intergenic
1167810681 19:51827306-51827328 ACAGTGAGAGAAATCTAACGTGG - Intergenic
925438839 2:3866698-3866720 ACAGCAAGAGAAATCTGACATGG + Intergenic
926496968 2:13602067-13602089 ATTGTTAGAGATTTCTGACATGG + Intergenic
927082972 2:19648683-19648705 AGGGTGGGAGCAAACTGACATGG - Intergenic
927162898 2:20285810-20285832 AAGGAGAGAAAAATCAGACAGGG + Intronic
927594955 2:24388115-24388137 ACAGTAAGAGAAATCTGACATGG - Intergenic
927870739 2:26621725-26621747 GTGGTGAGAAGAATCTGAGATGG + Intronic
928671315 2:33606388-33606410 ATAATGAGCGAAATCTAACAGGG - Intergenic
928931195 2:36626132-36626154 ACAGTGAGAGAAATCTAACATGG - Intronic
928933017 2:36645114-36645136 ACAGTGAGACAAATCTAACATGG - Intronic
929283229 2:40106185-40106207 ATGGTGAGAGAAAAGTGAAAAGG - Intronic
929685391 2:44029570-44029592 ATGGTGAGAGCAATCTGCCTGGG - Intergenic
929967500 2:46546338-46546360 ATTGTAAGACAAATCTGATATGG - Intronic
930164090 2:48186763-48186785 ACAGTTAGAGAAATCTTACATGG + Intergenic
931441109 2:62291230-62291252 ATAATGAGAGAAATCTAACATGG + Intergenic
932458249 2:71863733-71863755 AAGCTGAAAGAAATCTGGCAGGG - Intergenic
932626690 2:73302142-73302164 AAGGTGAGAGAAAAAAGACAAGG + Intergenic
934677337 2:96258875-96258897 AATGTGAGTGGAATCTGACACGG - Intronic
935644466 2:105322782-105322804 ATGGTCTGAGAAATCTCCCATGG - Intronic
935822127 2:106905099-106905121 AATGTGAGAAATATCTGACAAGG - Intergenic
936740285 2:115497403-115497425 ATAATGAAAGAAATCTAACATGG - Intronic
937010579 2:118559412-118559434 ACAGTAAGAGAAATCTGACATGG - Intergenic
937140454 2:119595748-119595770 GTGGTGAGAAAAATAAGACATGG + Intronic
937634042 2:124135705-124135727 GTGGTGAGAAATATTTGACAGGG - Intronic
937772870 2:125742455-125742477 CTTGTGAGAAAAATCTGTCAAGG + Intergenic
937860241 2:126702427-126702449 TTGGAGGGAGAATTCTGACATGG + Intergenic
938096255 2:128466028-128466050 ATAGTAAGAAAAATCTGACATGG + Intergenic
939091592 2:137786464-137786486 AGGGTGAGAGAAATCTAACATGG + Intergenic
939187956 2:138882594-138882616 ATCGTGGGAGTAATCTGACAAGG + Intergenic
939380857 2:141434849-141434871 ATGCGGAGAGAAATCTGAGTAGG - Intronic
939430654 2:142101942-142101964 ATGGAGAGAGAAAACTTACATGG + Intronic
939519898 2:143216887-143216909 GAGGTGAGAGAAATTTGAAAAGG + Intronic
940066178 2:149632589-149632611 ATGGTGAGAGAGACTTTACATGG + Intergenic
940176080 2:150878866-150878888 ACTGTAAGAGAAATCTGACATGG - Intergenic
940176679 2:150885204-150885226 ATAGTAAGAGAAAATTGACAGGG - Intergenic
941960115 2:171245193-171245215 ACAGTGAGAGAAATCTAACATGG + Intergenic
943183257 2:184572216-184572238 ATGGTGAGAGATTTATTACATGG + Intergenic
943851480 2:192728831-192728853 AGGGTGATAGAAATCTAATAAGG - Intergenic
945157309 2:206853094-206853116 ATGGGGAGAGAAAACTGAGGAGG + Intergenic
945348058 2:208743205-208743227 ATGCTTTGAGAAAACTGACAAGG + Intronic
946511508 2:220361780-220361802 ATGGTGACAGAAATGTTAAAGGG + Intergenic
946589355 2:221226412-221226434 ATGGTAATAGAAATCAGAAAAGG - Intergenic
946760227 2:222986066-222986088 ACAGTGAGAGAAGTCTAACAGGG - Intergenic
947252837 2:228126972-228126994 CTGGTGAGAGAAATAAAACAAGG - Intronic
1168916775 20:1495129-1495151 ATGGTGATAGAAATCAGAGGTGG - Intergenic
1169036700 20:2459010-2459032 ACAGTAAGAGAAATCTGACATGG + Intergenic
1169276174 20:4235118-4235140 GTGGTGAGAGGTAACTGACAGGG + Intronic
1170557906 20:17530520-17530542 ATGGTGATAGAAATCAGAATGGG + Intronic
1172395797 20:34603929-34603951 AAGGTGAGAGAAATGAAACAGGG + Intronic
1174913987 20:54636129-54636151 ACAGTAAAAGAAATCTGACATGG + Intronic
1174921098 20:54702924-54702946 ATAATTAGAGAAATGTGACAAGG - Intergenic
1175262816 20:57685382-57685404 GAGGGGAGAGAGATCTGACAAGG - Intronic
1176985269 21:15428809-15428831 ATGGTGAGAGAAAGCACATAGGG - Intergenic
1177851263 21:26351294-26351316 AAGGTGAGGAAAATCAGACATGG + Intergenic
1178858731 21:36271763-36271785 ATGGTGATAGAAATCTGTGTGGG + Intronic
1179729385 21:43359124-43359146 ATGCTGAGATAATTCTGCCAGGG - Intergenic
1180237969 21:46476523-46476545 ATGGAGAGAGCCATCAGACAGGG + Intronic
1181894232 22:26092933-26092955 ATGCTCAGAGAGATCTCACAGGG - Intergenic
1182319540 22:29469829-29469851 ATGGTGACAGACATGAGACATGG - Intergenic
1183026664 22:35070495-35070517 AAGGTGATAGAAAATTGACAAGG + Intronic
950053075 3:10006780-10006802 ATGCAGAGAGACATTTGACATGG - Intronic
951895366 3:27605134-27605156 ACAGTGAGAGAAATCTGACATGG + Intergenic
952497646 3:33929793-33929815 ATGGTCAGACAAACGTGACATGG + Intergenic
952619668 3:35322586-35322608 ATGGTGAGAGAAATCTAGCATGG - Intergenic
953383528 3:42492028-42492050 AGGGTGAGAGAAAGCAGTCAGGG + Intronic
953771897 3:45783885-45783907 ATATTGAGAGAAAACTCACAAGG - Intronic
953777583 3:45834860-45834882 CTGGTGAGAAAACTCTGAGAAGG - Intronic
955154399 3:56402366-56402388 ATGGTAATGGAAAACTGACATGG + Intronic
955724776 3:61921333-61921355 ATGATGACAGAAAGCTGAGATGG + Intronic
955761362 3:62287073-62287095 AAGGTGAGAATAATCTCACATGG + Intronic
956519164 3:70084642-70084664 ATGGGGAGGGAAAGCTGTCATGG - Intergenic
956734354 3:72226477-72226499 CTGCTGAGAGAAATAAGACAAGG - Intergenic
958930251 3:100199874-100199896 ACAGTAAGAGAAATCTGACATGG - Intergenic
959053540 3:101547310-101547332 ATAGTAAAAGAAGTCTGACATGG + Intergenic
959387841 3:105734250-105734272 ATGGTAACAAAATTCTGACAAGG - Intronic
960442957 3:117711442-117711464 AGGTTGAGAGAAATCTGAGTAGG + Intergenic
960627791 3:119698428-119698450 ACAGTGAGAAAAATCTGACATGG - Intergenic
960855488 3:122098260-122098282 ATGGTTAGAGAAATCTCCCTGGG + Intronic
962891465 3:139676658-139676680 ATTCAGAGAGAAATCAGACAGGG - Intronic
963487930 3:145960027-145960049 ATGGGGGGAGAATTCTTACAAGG + Intergenic
963543610 3:146626778-146626800 GTGGGGAGAGAAAGTTGACAAGG - Intergenic
964042367 3:152276930-152276952 ATGCTGAGAGAAATGTGATAAGG + Intronic
964889967 3:161522718-161522740 ATAGAGAGAGGAATGTGACAGGG + Intergenic
964920631 3:161891459-161891481 ATACTGAGAGAAATCTGACATGG + Intergenic
965870725 3:173261267-173261289 ACAGTGAGAGAAATCTAGCATGG - Intergenic
966123893 3:176552846-176552868 ATAGTGAGAGAATTCTTACAAGG - Intergenic
966217066 3:177514876-177514898 ATGTTGAGAGAAATATGACAGGG + Intergenic
966219426 3:177535792-177535814 CTGGTGAGAGAAATATGAACAGG + Intergenic
966416781 3:179697385-179697407 AGGGTGAGAGAACACTGACCTGG + Intronic
966961724 3:184946430-184946452 ACGGTGAGAGAAATCTAGCATGG - Intronic
967252481 3:187555247-187555269 ATGGTGAAAGAATTCAGAAAGGG - Intergenic
967877427 3:194276776-194276798 AGGGTGAGAGAAATGGCACAGGG + Intergenic
968009380 3:195263674-195263696 ATGGTGAGAGAAAACAGACAAGG + Intronic
970226775 4:13867093-13867115 ATAATGAGAGAAATGTTACATGG + Intergenic
970478930 4:16453128-16453150 ATGGTGGGATGAATCTGAGATGG + Intergenic
970710400 4:18855484-18855506 AAGATGAGAGAAATATGAGAAGG - Intergenic
971238260 4:24863498-24863520 ACAGTAAGAGAAATCTGACATGG + Intronic
971610405 4:28717777-28717799 ATGATGAGAGAGAACTGACCAGG + Intergenic
971642915 4:29158406-29158428 ACTGTGAGGGAAATCTAACATGG - Intergenic
973595523 4:52484803-52484825 ATGGTGAGAAAAACCAGAAATGG - Intergenic
973992808 4:56427444-56427466 ATGGTGATAGAAATGTAAAATGG - Intronic
975486216 4:74936151-74936173 AAGGAGAGAGAAATCTTAGATGG + Intronic
975514813 4:75234874-75234896 GTGGTGATAAAAAACTGACAAGG - Intergenic
975851055 4:78572994-78573016 ACAGTAAGAGAAATCTGACATGG - Intronic
975989108 4:80238453-80238475 ATGGTGAGACATTTCTAACAAGG - Intergenic
976238786 4:82931368-82931390 ATAGTGGGGGAAAACTGACATGG - Intronic
976746608 4:88409364-88409386 ACAGTAAGAGAAATCTGACATGG - Intronic
976943259 4:90732796-90732818 ATGGTAAGTGAAATATGCCAAGG - Intronic
977672670 4:99714400-99714422 ACAGTCAGAGAAATCTGACGTGG + Intergenic
978828802 4:113057490-113057512 ATTGTGAGTGGACTCTGACATGG + Intronic
978864916 4:113495881-113495903 ATGGTGACAGAAATGACACAAGG + Intronic
979087310 4:116429038-116429060 AATGTGAGAGAAATGTGAGATGG + Intergenic
980121120 4:128729362-128729384 ATTCTGAGAGAAATCTAACGTGG + Intergenic
980173493 4:129317196-129317218 ATGGTGTAAGAAATCAGTCAAGG + Intergenic
980308413 4:131095730-131095752 ATGGTGAAAGAAATCGGGCAGGG + Intergenic
980819498 4:137994944-137994966 AGAGGGAGAGAAATCTAACATGG - Intergenic
981024694 4:140065768-140065790 ATGATGAGAATAATCTCACATGG - Intronic
982338815 4:154271929-154271951 AAAGTGAGAGAAAACTGAAATGG - Intronic
982581635 4:157186528-157186550 ATGGTGAGAGAAAATAAACAGGG - Intergenic
983085888 4:163443603-163443625 AGGGAGAAAAAAATCTGACAAGG - Intergenic
983532753 4:168828636-168828658 ATTGTGAGAAAAATATGAAAAGG + Intronic
983533689 4:168835085-168835107 ATTGTGAAAGAAATCTGGAAAGG - Intronic
983626327 4:169805262-169805284 ACAATGAGTGAAATCTGACATGG + Intergenic
983886499 4:172986152-172986174 ACAGTGAGAAAAATTTGACATGG - Intronic
984317728 4:178148688-178148710 ACAGTGAGATAAATCTGACAAGG - Intergenic
985178367 4:187227832-187227854 AAGCTGAGAGAAATTTGAGATGG + Intergenic
985196746 4:187438377-187438399 ACGGTGAGAAAAATCTAATATGG - Intergenic
986248456 5:6032312-6032334 ATGATGAGACAATTGTGACATGG + Intergenic
986619333 5:9655107-9655129 ATGGTGATAGAAATCAGAAGAGG + Intronic
988637892 5:33006892-33006914 ATGGTAAGAAAAACCAGACATGG + Intergenic
988867000 5:35346125-35346147 AAAGTGAGAGAAGTCTAACATGG - Intergenic
990205682 5:53426500-53426522 ATGGTGAGACAAAAGTCACAAGG - Intergenic
990345724 5:54869122-54869144 ATGGTAACAGAGATCTGCCAGGG + Intergenic
990577270 5:57135492-57135514 AGAGTGAGAGAAATTTAACAGGG - Intergenic
990955471 5:61334021-61334043 AGGGTGACAGAAAACTGAAAGGG - Intronic
992861986 5:80920591-80920613 ATGGTGACAGAGATCAGACTAGG - Intergenic
993013223 5:82507697-82507719 ACAGTGAGAGAAATCTAACATGG + Intergenic
993482763 5:88445211-88445233 ATGGTGAGATCAATGTGGCAAGG - Intergenic
994065153 5:95531439-95531461 ATGGTGAGAAAATATTGACAAGG - Intronic
995075450 5:107978167-107978189 ACAGTGAGAGAAATCTAACATGG + Intronic
996297870 5:121944671-121944693 ATGGTGAGCAAAATCAGACATGG + Intergenic
996387942 5:122928494-122928516 TAGGTTAGAGAAATATGACAAGG + Intronic
997401419 5:133606030-133606052 AGGGTGTGTGAAATCTTACAGGG + Intronic
999276794 5:150336779-150336801 ATGGTGAGACAAAGCAGACTCGG + Intronic
999325507 5:150641119-150641141 ATGGCGAGCGCAATCTGACTGGG - Intronic
999968473 5:156835029-156835051 AGGGTGAGAGAAATCTGCAAAGG - Intergenic
1000387824 5:160692042-160692064 ATAGTGAGAGAAGTCTGATATGG - Intronic
1001385002 5:171331368-171331390 ATTGTAGGAGAAATCTGGCAAGG + Intergenic
1002282221 5:178138016-178138038 ATGGTGAGAGGGATCTGAAGAGG + Intronic
1004232690 6:13847274-13847296 ATAATGAGAGAAATCTGACATGG + Intergenic
1004604665 6:17182852-17182874 ACACTAAGAGAAATCTGACATGG + Intergenic
1005249004 6:23922794-23922816 AAGGAGAGAGAAATGTCACATGG + Intergenic
1005761016 6:28968379-28968401 ACAGTGAGAGAAATCTAACATGG + Intergenic
1006531711 6:34660727-34660749 AATGTGAGAGGAATCTAACATGG + Intronic
1007012614 6:38432289-38432311 ACAGTGAGAGAAATCTCGCATGG + Intronic
1008103414 6:47416926-47416948 ACAGTGAGAGAAATCTAACATGG - Intergenic
1008476144 6:51937915-51937937 ACAGTGAGAAAAATCTAACATGG + Intronic
1008561316 6:52727593-52727615 ATTGTGAGGTAAATCTTACAAGG + Intergenic
1009348295 6:62644860-62644882 GCAGTAAGAGAAATCTGACATGG + Intergenic
1009892703 6:69707152-69707174 ATGGAGGGGGAAATGTGACAAGG - Intronic
1010729839 6:79379683-79379705 ACAGTAAGAGAAATCTGACATGG + Intergenic
1012602561 6:101115847-101115869 ATGCAGAGGGAAATCTGACTTGG + Intergenic
1012618004 6:101301871-101301893 ACAGTGAAAGAAATCTAACACGG + Intergenic
1012691772 6:102322404-102322426 ATGGGGCAGGAAATCTGACAGGG - Intergenic
1013660516 6:112291651-112291673 AGGCTGACAGAAATCTGACCAGG - Intergenic
1013769706 6:113614041-113614063 ACAGTGAGAGAAATCTAGCATGG - Intergenic
1014469448 6:121797263-121797285 ACAGTGAGAGAAATCTAACATGG + Intergenic
1014882071 6:126735720-126735742 ACAGTAAGAGAAACCTGACATGG + Intergenic
1014909477 6:127073305-127073327 AAGATGAGAGAAATATGCCAGGG + Intergenic
1015026980 6:128546090-128546112 AAGATGAGTGAAATCCGACAAGG + Intergenic
1015323122 6:131898246-131898268 ACAGTGAGAGAAATCTAACGTGG - Intergenic
1015634540 6:135262807-135262829 ATGGTGAATGAAAGCTGAGATGG + Intergenic
1017014650 6:150090284-150090306 TTGGTGAGAGTATGCTGACAAGG - Intergenic
1019674205 7:2301680-2301702 ATGGTGATGGTAAACTGACATGG + Intronic
1020450981 7:8320183-8320205 ACAGTGAAAGAAATCTAACATGG - Intergenic
1021479873 7:21104331-21104353 ACGGTAAGAGAAATCTAGCATGG - Intergenic
1022487945 7:30794771-30794793 ATGGTGAGAGGAACCCAACAAGG - Intronic
1023606766 7:41938376-41938398 AGGGAGAGAGAAATCAGACAGGG + Intergenic
1024006311 7:45226991-45227013 ATGGTGAGAAAGATGGGACATGG - Intergenic
1024029910 7:45451046-45451068 ACAGTGAAAGAAATCTAACATGG - Intergenic
1024362586 7:48483863-48483885 ATTGAGAGAGAAATCAGAAAAGG + Intronic
1026290495 7:69001696-69001718 ACAGTAAGTGAAATCTGACATGG - Intergenic
1027161362 7:75804872-75804894 ACCGTGAGAGAAATCTGACATGG - Intergenic
1027745035 7:82062236-82062258 ACAGTGAGACAAATCTGACATGG - Intronic
1027750343 7:82136768-82136790 ATTGTGAAAGAAAGATGACAAGG - Intronic
1028143484 7:87296643-87296665 ATAGTAAGAGAAATCTGACATGG - Intergenic
1028926454 7:96361699-96361721 ACAGTAAAAGAAATCTGACATGG - Intergenic
1029358816 7:100073121-100073143 ATGGGGAGAGACATGGGACAAGG + Intronic
1029600332 7:101559522-101559544 ATGGTGATGGCAAACTGACATGG + Intergenic
1029945056 7:104524168-104524190 ATGGTGAGAGAAGTTAGACAAGG + Intronic
1030016964 7:105232673-105232695 ATGGGGAGAGATATTTGAAAAGG - Intronic
1030175429 7:106648807-106648829 CTGGCGGGAGAAACCTGACATGG - Intergenic
1031250477 7:119373687-119373709 AGGGTGAGAAAAGTCTGAAATGG - Intergenic
1031287898 7:119895365-119895387 ATAGTGAGGGAATTCTCACAAGG - Intergenic
1031664747 7:124470213-124470235 ACAGTGAAAGAAATCTGACATGG - Intergenic
1032412362 7:131705826-131705848 CTCGTGAGATAAATCTTACATGG + Intergenic
1033077100 7:138259822-138259844 ACAGTGAGAGAAATCGGACATGG + Intergenic
1033268969 7:139913662-139913684 ATGGTGAAAGAAATTAGAAACGG - Intronic
1033656444 7:143378209-143378231 ATGGAAAGAGAAATGTGACCAGG - Intergenic
1035214555 7:157355521-157355543 ATGGAGAGAGAAGTTGGACAAGG + Intronic
1035998710 8:4577940-4577962 ATGGCCAGAGAAAAATGACATGG + Intronic
1036763348 8:11528448-11528470 ACAGTAAGAGAAATCTGACATGG - Intronic
1037212614 8:16409709-16409731 ATGGTAAGAAAAATCTAGCATGG - Intronic
1037505150 8:19522194-19522216 TTAGTGAGAGAAATGTGGCATGG + Intronic
1037643160 8:20767044-20767066 ATGATGTTAGAAATCAGACATGG - Intergenic
1038443859 8:27589503-27589525 AGGGTGAGAGAAATCAGAGCAGG - Intergenic
1038967349 8:32589269-32589291 AAGGAGAGAGAAATATGACTGGG + Intronic
1039290643 8:36090780-36090802 GCAGTGAGAGAAATCTAACATGG - Intergenic
1039322365 8:36446188-36446210 ACAGTGAGAGAAACCTAACATGG - Intergenic
1039727305 8:40232707-40232729 ATAGCAAGAGAAGTCTGACATGG + Intergenic
1040019313 8:42726030-42726052 CTGGTGACAGAAACGTGACAAGG - Intronic
1040855393 8:51943628-51943650 ACAGTGACAGAAATCTAACAGGG + Intergenic
1041468241 8:58179664-58179686 TTGGTGAGGGAAATCAGTCATGG + Intronic
1042061317 8:64821369-64821391 ATGTTAAGAGAAAACTGAAATGG + Intergenic
1042896506 8:73675817-73675839 ATGATTAGTGAAATCTGAAATGG + Intronic
1043313625 8:78893599-78893621 ACAGAAAGAGAAATCTGACATGG + Intergenic
1044243463 8:89913360-89913382 ACAGTGAGAGAAATCTAACATGG - Intronic
1044367006 8:91359554-91359576 ATGGTGTGAGAAAGGTGACATGG + Intronic
1044573815 8:93747512-93747534 ACAGTGAGAGAAATCTAACATGG - Intergenic
1045648009 8:104318014-104318036 ACAGTGAGAGAAATATGGCATGG - Intergenic
1045649355 8:104327998-104328020 ACCGTAAGAGAAATCTGACATGG - Intergenic
1045804556 8:106143071-106143093 ATGTTGAGAGTAATCCAACATGG - Intergenic
1047928486 8:129703406-129703428 ATGATGATGGAAATCTGACATGG + Intergenic
1048489792 8:134882042-134882064 ATGGTCAGAGAAAGCTGATTAGG + Intergenic
1049920980 9:363891-363913 GTGGTGAGAGCAGTCTGGCAGGG + Intronic
1050119734 9:2296001-2296023 GTGGTGAGAGAAAGCTGGCCTGG - Intergenic
1050619458 9:7437362-7437384 ATAGTGAGAGGAATCTAGCATGG - Intergenic
1052126050 9:24775623-24775645 AGGGTAAAAGAAAGCTGACAAGG + Intergenic
1052561210 9:30087077-30087099 ATGGAGAGGGACATATGACAAGG + Intergenic
1053271356 9:36751880-36751902 ATGGAGAGAAAACCCTGACAGGG - Intergenic
1054888382 9:70224247-70224269 AAGGTGAGAGAGATATGAAAGGG + Intronic
1055191192 9:73526999-73527021 ATGGTGAGAGAAATCTAGCATGG + Intergenic
1055813749 9:80181342-80181364 ACAATGAGAGAAATCTAACATGG + Intergenic
1056755405 9:89378938-89378960 ACGGTCACAGAAATCTGACTTGG + Exonic
1058902715 9:109456267-109456289 ATGCAGAGAGAAATATAACAAGG + Intronic
1058982347 9:110181739-110181761 ACAGTGAGAGAAATCTAGCATGG - Intergenic
1059088011 9:111325516-111325538 ATGGTAAGGGAAAGCTGACTGGG - Intergenic
1061305706 9:129731912-129731934 ATGGCGATAGTAAACTGACATGG - Intergenic
1061468844 9:130806347-130806369 ATGGTAAGATAAATCTGCCTTGG + Intronic
1185857587 X:3550361-3550383 ATGGTAACAGTAAACTGACATGG - Intergenic
1186027444 X:5328249-5328271 ACAGTAAGAGAAACCTGACATGG - Intergenic
1186182023 X:6982854-6982876 ACAGTGAGAGAAATCTGACATGG - Intergenic
1186450125 X:9665378-9665400 ACAGTGAGAGAAATCTGACATGG + Intronic
1186450559 X:9669892-9669914 ACAGTGAGAGAAAACTGACCTGG + Intronic
1187112714 X:16318032-16318054 ACAGTGAGAGAAATCTAACATGG + Intergenic
1188718633 X:33496006-33496028 CTGGGGAGATAAATCTGAAAGGG - Intergenic
1189194205 X:39138727-39138749 ACAGTGAGATAAATCTGACATGG - Intergenic
1190028600 X:46949754-46949776 ATGGTGACAGAAATCAGAATAGG - Intronic
1190118921 X:47644717-47644739 ATGGGGAGAGGAGGCTGACATGG + Intronic
1190686253 X:52876435-52876457 ATAGTGAGAGAAATCGACCAGGG + Intergenic
1190699313 X:52974996-52975018 ATAGTGAGAGAAATCGACCAGGG - Intronic
1190750079 X:53354342-53354364 ATAGTGAGAGAATCCTCACAAGG + Intergenic
1192211605 X:69131352-69131374 CTGTGGAGAGAAATCAGACATGG + Intergenic
1192248274 X:69390764-69390786 ATGGTAAGGCAAATCTGAAAGGG - Intergenic
1192762965 X:74114573-74114595 AAGGTGAGAGATGTCAGACAGGG + Intergenic
1193147879 X:78096196-78096218 ATAGTGAGAGAAATGTGATGTGG + Intronic
1193910543 X:87300964-87300986 ACAGTGAGAGAAATCTAATATGG - Intergenic
1194778383 X:97992784-97992806 ATGGTGAGAGAAAAGTGATAGGG - Intergenic
1195046403 X:101058390-101058412 ACATTAAGAGAAATCTGACATGG + Intergenic
1196047119 X:111267935-111267957 ATGGTGAGAGAAAAGGGACTTGG + Intronic
1196048859 X:111283867-111283889 ATGCCGAGAAAAATCAGACAAGG + Intergenic
1197778221 X:130134522-130134544 TTGCTGAGACAAAACTGACATGG + Intronic
1199555938 X:149108816-149108838 ACAGTGAGAGAAATCCAACATGG + Intergenic
1199789250 X:151136222-151136244 ATTGTGAAAGCATTCTGACATGG - Intergenic