ID: 1092938541

View in Genome Browser
Species Human (GRCh38)
Location 12:13386314-13386336
Sequence CTGGGGAGAAGGAACAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 877
Summary {0: 1, 1: 0, 2: 12, 3: 99, 4: 765}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092938541_1092938550 0 Left 1092938541 12:13386314-13386336 CCTTCCTTGTTCCTTCTCCCCAG 0: 1
1: 0
2: 12
3: 99
4: 765
Right 1092938550 12:13386337-13386359 GCCCTGCAATTCTCAGGGATAGG 0: 1
1: 0
2: 1
3: 14
4: 156
1092938541_1092938554 12 Left 1092938541 12:13386314-13386336 CCTTCCTTGTTCCTTCTCCCCAG 0: 1
1: 0
2: 12
3: 99
4: 765
Right 1092938554 12:13386349-13386371 TCAGGGATAGGCCAATGGTTTGG 0: 1
1: 0
2: 0
3: 10
4: 139
1092938541_1092938546 -6 Left 1092938541 12:13386314-13386336 CCTTCCTTGTTCCTTCTCCCCAG 0: 1
1: 0
2: 12
3: 99
4: 765
Right 1092938546 12:13386331-13386353 CCCCAGGCCCTGCAATTCTCAGG 0: 1
1: 0
2: 2
3: 31
4: 295
1092938541_1092938548 -5 Left 1092938541 12:13386314-13386336 CCTTCCTTGTTCCTTCTCCCCAG 0: 1
1: 0
2: 12
3: 99
4: 765
Right 1092938548 12:13386332-13386354 CCCAGGCCCTGCAATTCTCAGGG 0: 1
1: 0
2: 3
3: 32
4: 254
1092938541_1092938555 19 Left 1092938541 12:13386314-13386336 CCTTCCTTGTTCCTTCTCCCCAG 0: 1
1: 0
2: 12
3: 99
4: 765
Right 1092938555 12:13386356-13386378 TAGGCCAATGGTTTGGTCCTTGG 0: 1
1: 0
2: 0
3: 22
4: 124
1092938541_1092938553 7 Left 1092938541 12:13386314-13386336 CCTTCCTTGTTCCTTCTCCCCAG 0: 1
1: 0
2: 12
3: 99
4: 765
Right 1092938553 12:13386344-13386366 AATTCTCAGGGATAGGCCAATGG 0: 1
1: 0
2: 0
3: 10
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092938541 Original CRISPR CTGGGGAGAAGGAACAAGGA AGG (reversed) Intronic
900209029 1:1444463-1444485 CTGGAGAGAAGGAATAGGAATGG + Intergenic
900318979 1:2073227-2073249 CTGGGGGGCAGGAACAGGAAAGG - Intronic
900597842 1:3490590-3490612 CTGGGGAAAAGGAGAAAAGAGGG + Intronic
900638242 1:3676048-3676070 CTGGGGACAGGGGACAAGGAGGG + Intronic
900638314 1:3676275-3676297 ATGGGGACAAGGGACAGGGAGGG + Intronic
900712406 1:4122660-4122682 CTGGGGAGGCGGGAGAAGGAGGG + Intergenic
900756667 1:4440174-4440196 CTGGGGTGAAGGAAAGAGGCTGG - Intergenic
900760995 1:4470356-4470378 CTAGGGAGAACGATCAAAGAGGG - Intergenic
900765470 1:4502102-4502124 CTGGGGAGAGGGGACAAGGAGGG - Intergenic
901037917 1:6347316-6347338 ATCCGGAGAAGGAGCAAGGAGGG + Intronic
901222971 1:7594362-7594384 CTGGGAGGAAGGAAAAAGAAAGG + Intronic
901776417 1:11563368-11563390 CTGGGGGACAGGGACAAGGAAGG + Intergenic
901919350 1:12525401-12525423 CAGGGGAGGAGGATCCAGGAAGG + Intergenic
902382195 1:16057996-16058018 CTGGGGGGCAGACACAAGGAGGG + Exonic
902875563 1:19338745-19338767 CCGGCGAGAAGGAACACAGAAGG + Intergenic
902918984 1:19655483-19655505 CTGGGGAGAAAGGCCAAGGCTGG - Intronic
903166590 1:21524711-21524733 CTGGGGAGGGGGAGCAAGGCAGG + Intronic
903172020 1:21560289-21560311 CTGGGTAGAAGGAATGAGCATGG + Intronic
903348734 1:22704754-22704776 ATGGAGAGAAGCAACCAGGAGGG - Intergenic
903539027 1:24086442-24086464 CTGGGCAGAAGGCTCATGGAGGG - Intronic
903719170 1:25391659-25391681 CAGGAGTGAAGGAACAAGGGTGG - Intronic
903802887 1:25982942-25982964 CTGGGGAGAAGTAACAAAATGGG - Intronic
904008544 1:27376776-27376798 CTGGAGAGTAGGACCAGGGAAGG + Intergenic
904316962 1:29671777-29671799 GTGGGAACAAGGAACACGGAAGG - Intergenic
904401844 1:30262091-30262113 CTGGGGAGGGGGAACAAGGAGGG - Intergenic
904688868 1:32279039-32279061 CTGGGCACCAGGAACATGGATGG + Intronic
905259486 1:36707339-36707361 CTGGGGAGAAGGAACGTGCAAGG - Intergenic
905278712 1:36835516-36835538 ATGTGGAGAAGGAAGGAGGAAGG - Intronic
905466542 1:38158530-38158552 CTGGGGATAAAGGACACGGATGG + Intergenic
905796923 1:40821028-40821050 CTGGGGAGGAGAGATAAGGAAGG - Intronic
905836541 1:41127797-41127819 CACAGGAGAAGGAAGAAGGAAGG - Intronic
905975410 1:42170648-42170670 CTAGGGAAAAGGAAAAAGAAAGG + Intergenic
906615062 1:47228368-47228390 TTGGGGAGAATGAAGGAGGAGGG + Intronic
906922828 1:50082909-50082931 CTGGGTACAAGGCACAATGAAGG - Intronic
907450582 1:54543178-54543200 CGGGGGAGAGGGACAAAGGAAGG - Intronic
908141070 1:61185448-61185470 ATGGTGTGAAGGAACAAGAATGG - Intronic
908466856 1:64404653-64404675 ATGGGGAGAAGGAAGCAAGAGGG - Intergenic
908746530 1:67382043-67382065 CTGGGCAGATGGAACAAGTTTGG - Intronic
908981210 1:69961531-69961553 CTGGGCAGAAAGAACAAAGCTGG + Intronic
909181057 1:72424619-72424641 GAGGGTAGAAGGAAGAAGGAGGG + Intergenic
909592935 1:77371867-77371889 CATGGGAGAAGGAAGAGGGAAGG + Intronic
910709554 1:90165625-90165647 CTCGGGAGTAAGAACTAGGATGG - Intergenic
910844511 1:91592570-91592592 CTGGGGAGGAGGTGCATGGAAGG - Intergenic
911558203 1:99371454-99371476 ATGGGGAGAAGGATGAAGCAGGG - Intergenic
911732854 1:101308266-101308288 CAGGGGAGAAGGACAAGGGAAGG - Intergenic
912757069 1:112333388-112333410 TTGGGGAGAAGGAAAGTGGAAGG - Intergenic
912816310 1:112831504-112831526 ATGGGCAGTAGGAAAAAGGATGG - Intergenic
913063147 1:115226099-115226121 CTGGGGAGGTGGAACAAGCAGGG + Intergenic
914801574 1:150966289-150966311 CTGTGGAAAAGGGACAAGAAGGG + Intronic
914876647 1:151517283-151517305 CTGAGGACTAGGAACAGGGATGG - Intronic
915347212 1:155203597-155203619 TTGGTGAGAAGGAGGAAGGAAGG + Intronic
916119390 1:161513962-161513984 CAGGAGAGAAGGGACAAGGCAGG - Intronic
916129151 1:161595620-161595642 CAGGAGAGAAGGGACAAGGCAGG - Intronic
916423558 1:164659660-164659682 CCAGGGAGAGGGAACAAGGGAGG - Intronic
916736723 1:167614147-167614169 CGGGAGAGAGGGAAGAAGGAGGG - Intergenic
917304115 1:173609244-173609266 ATGGGGAGAAGGAAAAGGAATGG - Intergenic
917399990 1:174637119-174637141 ATGGGGAGAAGGGGCAGGGATGG - Intronic
917554351 1:176068215-176068237 AGGGAGAGAAGGAAGAAGGAAGG - Intronic
918555061 1:185789233-185789255 GTTAAGAGAAGGAACAAGGATGG + Intronic
919847386 1:201650386-201650408 TTGGGGCCACGGAACAAGGACGG + Intronic
920058159 1:203207708-203207730 CAGGGGAGAAGAAAGAAGGAGGG + Intergenic
920126149 1:203695288-203695310 CTGGGGAGAAAGGACCAGCAAGG + Intronic
920654598 1:207866466-207866488 CGAGGGAGTAGGAACTAGGAAGG - Intergenic
920985429 1:210884650-210884672 CTGGGGAGAGTGAACAGGCAAGG - Intronic
921294363 1:213688231-213688253 TTGGGGAGAAGGAAGTGGGAGGG - Intergenic
921450922 1:215304437-215304459 TTGGGAAGAAGGAAAAAAGATGG - Intergenic
921456494 1:215378281-215378303 CTGGGAAGTAGGAACAGGAATGG - Intergenic
922226503 1:223650274-223650296 CTGGGCAGAAAGAATAAGGCAGG - Intronic
922251233 1:223850364-223850386 CAGGGCAGAGTGAACAAGGAGGG + Intergenic
922319427 1:224472630-224472652 CTGGGGAAAAGGATTGAGGATGG + Intronic
922802826 1:228371946-228371968 CTGGAGGGAAGGAGCCAGGAGGG - Exonic
923314058 1:232762298-232762320 CTGAGGAAGAGGAAGAAGGATGG - Intergenic
924136743 1:240975064-240975086 ATGGAGAGAAGGAAAAAAGATGG + Intronic
924708842 1:246518424-246518446 CTCGGGAGAAGCCACAGGGAAGG + Intergenic
924759938 1:246974420-246974442 CTGGGGAGAAAAAACAAGAGAGG + Intronic
1063191289 10:3697222-3697244 CTGGGGAGGAGGAATGAGGATGG - Intergenic
1063193317 10:3718041-3718063 CTGGGGAGAAAAAAGAGGGAGGG + Intergenic
1063222141 10:3979118-3979140 CTGGGGAGAACTCACAATGATGG - Intergenic
1063877272 10:10493271-10493293 CTGGGGAGAGGGGGCATGGATGG + Intergenic
1063918615 10:10909510-10909532 CAGGGCAGAAGGAACACGGGAGG - Intergenic
1064510480 10:16084437-16084459 CGGGGGAAAAGGAAAAAGAAAGG - Intergenic
1065083193 10:22147509-22147531 GTGAGGAGAAGGAACTAGGAGGG - Intergenic
1065927736 10:30450639-30450661 CTCTGGAGAAGGAAGACGGACGG - Intronic
1065971366 10:30808549-30808571 CTGTGCAGAAGGAAGCAGGATGG + Intergenic
1066224131 10:33365811-33365833 CAGGGGAGAAGGAAGGGGGATGG - Intergenic
1066227154 10:33394390-33394412 TAAGAGAGAAGGAACAAGGAGGG + Intergenic
1066533729 10:36367526-36367548 GAGGGAAGAAGGAACAAGGAAGG + Intergenic
1066718174 10:38308977-38308999 CTGGGGGGAAGGATCATGGGAGG + Intergenic
1067217715 10:44316646-44316668 CTGGTGGGAGGGGACAAGGATGG - Intergenic
1067497602 10:46774115-46774137 CTGGGGCGGGGGAACAGGGAGGG + Intergenic
1068382359 10:56273218-56273240 CTGATGAGCAAGAACAAGGATGG + Intergenic
1069939525 10:71944984-71945006 ATGGGCAGTAGGAAAAAGGATGG - Intergenic
1069980341 10:72248067-72248089 CTGAAGAGAGTGAACAAGGAGGG - Intergenic
1070343970 10:75523783-75523805 CAGGGAAGAAGGGAGAAGGATGG - Intronic
1070489646 10:76964606-76964628 CTGGGCAAAAGAAAGAAGGAAGG - Intronic
1070555924 10:77527736-77527758 GTGAGGAGGAGGCACAAGGAAGG + Intronic
1070735443 10:78860832-78860854 CTGGGGAAAAGGGCAAAGGAAGG - Intergenic
1071107360 10:82113979-82114001 CTGGGGAGTAGGGAGAAGGCTGG - Intronic
1071312083 10:84352476-84352498 TTGGGGAGTAGGAAGAATGACGG + Intronic
1071793297 10:88979213-88979235 CTGGGGAGGAGAGATAAGGAAGG + Intronic
1071996332 10:91153222-91153244 GTGGAGAGAAGGAACCAGCATGG - Intergenic
1072222299 10:93336780-93336802 CAGGAGAAAAGGAAGAAGGAAGG + Intronic
1072335164 10:94391392-94391414 ATGGGCAGTAGGAAGAAGGATGG - Intergenic
1072412487 10:95216388-95216410 CTGGAGATCAGGATCAAGGAAGG + Intronic
1072534635 10:96352816-96352838 CTGGAGCGAAGGAGAAAGGAGGG - Intronic
1073148074 10:101293216-101293238 CTGGGGAGGAGGGACAAAGAGGG - Intergenic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073785687 10:106886599-106886621 CAGGAAAGAAGGAAGAAGGATGG + Intronic
1074204650 10:111272248-111272270 AGGGGGAGAAGGAAGAAAGAGGG + Intergenic
1074740102 10:116478293-116478315 CTGGGGAGAAGGAGGAAAGCAGG + Intergenic
1075575037 10:123571775-123571797 CTGGGGTGAAGGAAGCTGGACGG + Intergenic
1076418770 10:130312959-130312981 CTAGGGAGAAGCAGAAAGGAGGG + Intergenic
1076558701 10:131346976-131346998 AAGGAGAGAAGGAAGAAGGAAGG - Intergenic
1076558713 10:131347023-131347045 AAGGAGAGAAGGAAGAAGGAAGG - Intergenic
1076558724 10:131347070-131347092 GAGGGGAGAAGGAAGAAGAAAGG - Intergenic
1076561809 10:131371852-131371874 CTGGGGAAAGGGAGCAAGTAGGG - Intergenic
1076625272 10:131818004-131818026 AAGGGGAGCAGGAAGAAGGAAGG + Intergenic
1076744209 10:132504692-132504714 CTGGGTAGAAGGAAACAGCAGGG - Intergenic
1076768743 10:132651504-132651526 CGGGGGAGATGGAACCAGGCCGG - Intronic
1076984202 11:223620-223642 GTGAGGAGAAGGGAGAAGGATGG - Intronic
1077516215 11:3003566-3003588 CTAGGGAAAAGAAACCAGGAAGG + Intronic
1077761359 11:5103140-5103162 CTGGAAGGAAGGAAGAAGGAAGG + Intergenic
1078344012 11:10527316-10527338 CAGGGGAGAAGGAACGCTGAGGG + Intronic
1078429704 11:11279731-11279753 CTGGGAAGAAGGGACTGGGAAGG + Intronic
1079128629 11:17735267-17735289 GCGGGGAGAAGGAACGAGGAGGG + Exonic
1080051594 11:27864208-27864230 CGGGAGGGAGGGAACAAGGAAGG + Intergenic
1080568975 11:33538616-33538638 CTGGGGAGAAGAAAGACAGAGGG + Intergenic
1080729780 11:34937468-34937490 GTGGGTGGAAGGAGCAAGGAAGG + Intronic
1080871636 11:36241750-36241772 CAGGGAAGAAGTAGCAAGGAGGG - Intergenic
1080880138 11:36312091-36312113 CTTGGGAGTAGGAACAGGGTAGG + Intronic
1081005423 11:37730683-37730705 GTAGGGAGAAGAAACAAGCATGG + Intergenic
1081432034 11:42986933-42986955 CTGAGGAAAATGTACAAGGAAGG + Intergenic
1082059851 11:47850478-47850500 CTGGAAAGAAGGAAGGAGGAAGG + Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1082728817 11:56770101-56770123 CAGGGGCCAAAGAACAAGGAAGG + Intergenic
1083134872 11:60662843-60662865 GTGGGGAGATGGAAAAAGAAGGG - Intergenic
1083555491 11:63622939-63622961 CTGGGGAGAAGGAAGGACCAGGG - Intergenic
1083838807 11:65291105-65291127 CTGGGGAAAAGGGACAGGAATGG - Intronic
1084009134 11:66338062-66338084 TTGAGGAGCAGGAACCAGGATGG - Intronic
1084055101 11:66626839-66626861 CTGAGGCGAAGGAACAAAGTAGG - Exonic
1084209616 11:67614989-67615011 CTGGAGGGGAGGAACAGGGAGGG - Intergenic
1084515364 11:69635062-69635084 TAGGGGAGAAGAAAGAAGGAAGG + Intergenic
1084958971 11:72706269-72706291 CTGGGTAGAAAGATGAAGGAGGG - Intronic
1085240092 11:75045931-75045953 ATGGGCAGTAGGAAGAAGGATGG - Intergenic
1085518762 11:77126181-77126203 CTGGGGGGAAGGGACAATGGAGG + Intergenic
1086203778 11:84234342-84234364 ATGGGCAGAAGGCAGAAGGAGGG - Intronic
1086774332 11:90811121-90811143 GAGGGGAGAAAGAACTAGGATGG + Intergenic
1087382205 11:97420661-97420683 CTGATCAGAAGGAACAAGAATGG - Intergenic
1088146022 11:106679756-106679778 CTGGGTTGAAGGAACAAAGAAGG - Intronic
1088345435 11:108819243-108819265 CTGGGGAGAAAAAACAGGAAAGG - Intronic
1088718547 11:112571883-112571905 CTGGGGAAATTGAACAATGATGG + Intergenic
1088888972 11:114030022-114030044 CTTGGGAGTAGGATGAAGGATGG - Intergenic
1088917595 11:114239237-114239259 CTGGGCAGAGGGAACATGAATGG - Intronic
1089220828 11:116870058-116870080 CAGGGGACAAGGAAGAAGGAGGG + Intronic
1089474911 11:118751822-118751844 CTGGGGAAAGGGGACAAGGAAGG - Exonic
1089624753 11:119744258-119744280 GTGGGGAGGAGGAAGAAGAAAGG - Intergenic
1089645939 11:119879020-119879042 CTGGGGAGGATGAGCAAGGGAGG + Intergenic
1089847221 11:121467712-121467734 CTGGAGAGGAGGAAAAGGGAAGG + Intronic
1089913700 11:122129961-122129983 GTGGGGAGAAGGAATAAAGAGGG + Intergenic
1089950602 11:122522159-122522181 ATGAGGAGAAAGAAGAAGGAAGG + Intergenic
1090169312 11:124584816-124584838 GTGGGGAGAAGGAAAAGAGAAGG + Intergenic
1090274497 11:125410071-125410093 CTGGGGAGGAGCTAGAAGGAGGG + Intronic
1090504371 11:127296115-127296137 CTGGGGAGAGGCAACAAGATTGG - Intergenic
1090672447 11:128958279-128958301 CGGAAGAGAAGGAACAATGAAGG - Intergenic
1090765390 11:129871759-129871781 CTGGGTAGAATGAACAATGGGGG - Intronic
1091100293 11:132866048-132866070 CTGAGGAGAAGAGAGAAGGATGG - Intronic
1091554191 12:1559886-1559908 CTGGGGAGAAGGAGTAAAAATGG - Intronic
1092138451 12:6166418-6166440 CTGTGGAGAGGGAGCATGGAAGG - Intergenic
1092299124 12:7228482-7228504 CTGGAGATCAGGATCAAGGAAGG + Intergenic
1092938541 12:13386314-13386336 CTGGGGAGAAGGAACAAGGAAGG - Intronic
1093111791 12:15161467-15161489 ATGGGAAGAAGGAGGAAGGAAGG - Intronic
1093289599 12:17303783-17303805 ATGGGTAGCAGGAAAAAGGATGG - Intergenic
1093705920 12:22275069-22275091 CTTGGGAGAGGGAACTGGGAAGG + Intronic
1094497008 12:30994889-30994911 CTGGGGAGAAGGAAGAAAACTGG + Exonic
1094723611 12:33089970-33089992 CTGAGGTGAAGGATCAAGGCAGG + Intergenic
1094782871 12:33813080-33813102 TTAGCGAGAAGGAAGAAGGAAGG + Intergenic
1096111037 12:49029360-49029382 ATGGGGATGAGGAACAAGGGTGG - Intronic
1096575585 12:52550732-52550754 CTGGGGAGCAGGACCAAGGAGGG - Intronic
1096630666 12:52924983-52925005 CTGTGGAAAAGGAACAGGGCTGG + Intronic
1097008957 12:55939013-55939035 CAGGGAAGAAGGTACAAGAAGGG - Intronic
1097010704 12:55951800-55951822 CTGGGGAGAAGGGAGAAAGGGGG + Intronic
1097167811 12:57094899-57094921 CTGGAGAGAGGACACAAGGAGGG + Exonic
1097180057 12:57166697-57166719 CTGGAGAGGAGGAACAAGGCAGG + Intronic
1098095051 12:66946001-66946023 CTGTGTAGCAGGAAGAAGGAAGG - Intergenic
1099102683 12:78461331-78461353 CAGGGGAGAAGGACAAGGGAAGG + Intergenic
1099201776 12:79686535-79686557 GTGGGGTGAAGGGACAAAGAGGG + Intronic
1100448966 12:94687093-94687115 CTGGGGATAAGGAAGGATGATGG + Intergenic
1100913846 12:99395190-99395212 ATGGGGAGAGGGAACAAGGGTGG - Intronic
1101345038 12:103878953-103878975 CAGGGGAGAAGGAAGCAGCAAGG - Intergenic
1101498804 12:105281746-105281768 CTAGGCAGGAAGAACAAGGAAGG - Intronic
1101585179 12:106079462-106079484 CAAGGGAGAAGGATCAGGGAAGG + Intronic
1102167835 12:110820676-110820698 CTGGGGAGAGGGGAGGAGGAGGG - Intergenic
1102423190 12:112820242-112820264 CTGGAGAGAACGAACACTGATGG + Intronic
1102601107 12:114031299-114031321 CAGGGCAGAAGGGAAAAGGAAGG - Intergenic
1102929053 12:116848779-116848801 GGAGGGAGAAGGAACAGGGAGGG - Intronic
1103322733 12:120101372-120101394 GAGGGGAGAAGTGACAAGGAAGG - Intronic
1103883821 12:124186312-124186334 TTGGGGAGGAGGTAGAAGGAGGG + Intronic
1104044332 12:125151315-125151337 CTACGCAGAAGGAAGAAGGACGG - Intergenic
1104751169 12:131240079-131240101 CTGGAGAGAAAGATCTAGGAAGG + Intergenic
1106158981 13:27183759-27183781 CTTGGCAGAAGGAACAATGTGGG - Intergenic
1107250694 13:38357847-38357869 CTGAGGAGAAGGAAGAGGAAGGG + Intronic
1107419719 13:40234911-40234933 CTGGGCAGAAGGAAAAAGGCTGG + Intergenic
1107614315 13:42148864-42148886 CGGGGAAGAAGCCACAAGGAGGG - Intronic
1108422801 13:50267738-50267760 GTGGTGAGAAGGTACCAGGAGGG - Intronic
1108949920 13:56078833-56078855 CTGTGGAGAGGGAACAGGAAAGG - Intergenic
1109239557 13:59868718-59868740 CTGAGGAGAGGGAAGAAGGAAGG - Intronic
1110386070 13:74912185-74912207 CTTGGGGGAAGGAACATAGAGGG + Intergenic
1110679367 13:78290325-78290347 CTGGGCAAAAAGAACAAAGACGG - Intergenic
1111295902 13:86277524-86277546 CTGGGGAAATGGGACAAGGAAGG + Intergenic
1111498422 13:89084983-89085005 AGGAGGAGAAGGAAGAAGGAGGG + Intergenic
1112177965 13:97047294-97047316 ATGAGGAGAAGGAATGAGGAGGG - Intergenic
1113301996 13:109032396-109032418 CTGGGAAGAAGCACAAAGGATGG - Intronic
1113414896 13:110120925-110120947 GTGGGGAGAGGGGAGAAGGATGG - Intergenic
1113680835 13:112243757-112243779 CTGTGGAGAAGGAGCAGGGCAGG + Intergenic
1113982409 13:114287671-114287693 CTGGGGAGACAAAACAAGAAGGG - Intronic
1114423230 14:22602049-22602071 TGGGGGAGAAGGAAGGAGGAAGG - Intronic
1114522071 14:23346198-23346220 CTGGGGGCAGGGCACAAGGAGGG + Intergenic
1114761909 14:25325351-25325373 CTGGGGAAAAGCATCAAGGTGGG + Intergenic
1115058715 14:29164609-29164631 TGGGGGAAAAGAAACAAGGAAGG - Intergenic
1115148043 14:30249377-30249399 CTTGAGAGAAGGAACCAGAATGG - Intergenic
1115307633 14:31948680-31948702 CAGGGGAGTAGGATCAAGAAGGG - Intronic
1116250193 14:42472368-42472390 TTTGCAAGAAGGAACAAGGAAGG - Intergenic
1117277962 14:54208609-54208631 CTGGGGAAAAAGAACATGAAGGG + Intergenic
1117478567 14:56119727-56119749 CTGGGGGGAAGGAACAACTTGGG + Intronic
1117954943 14:61115570-61115592 ATGGGCAGTAGGAAAAAGGATGG + Intergenic
1118349818 14:64965746-64965768 CTGGGGAGCGGGGAGAAGGAAGG + Intronic
1118680034 14:68231431-68231453 TAGGGGAAAAGGAAAAAGGAGGG - Intronic
1118775662 14:68972364-68972386 CAGGGGAAGAGGGACAAGGATGG + Intronic
1118935420 14:70283547-70283569 CTGGGTGGTAGCAACAAGGAGGG + Intergenic
1119000062 14:70873572-70873594 ATGGGGAGCAAGAAAAAGGATGG - Intergenic
1119006122 14:70931087-70931109 CTGGTGAGAAGGGAGAAAGAAGG - Intronic
1119129895 14:72162423-72162445 CTGGGGAGTAGAAAGAAGTAGGG + Intronic
1119601357 14:75979275-75979297 CTGGAGAGAAGGAACAGGAGTGG - Intronic
1119922208 14:78456962-78456984 AGGAGGAGAAGGAAGAAGGAAGG - Intronic
1120849384 14:89155631-89155653 GAGGGGAGTGGGAACAAGGAAGG - Intronic
1120954668 14:90071477-90071499 GTGGGGAGATGGGACCAGGAGGG - Intronic
1121071172 14:91023133-91023155 CTGAGACTAAGGAACAAGGATGG - Intronic
1121939254 14:98054022-98054044 CTGGGGAGCAGATACAAAGAAGG - Intergenic
1122126083 14:99579490-99579512 CTGGGCAGAAGGACCAGGGCTGG - Intronic
1122580326 14:102767744-102767766 CTGGGGAGAGGGAACCAGCCAGG + Intergenic
1123113156 14:105882333-105882355 CTGCGGGGAAGGACCAGGGACGG - Intergenic
1123115506 14:105892485-105892507 CTGCGGGGAAGGACCAGGGACGG - Intergenic
1123576959 15:21680229-21680251 CTGAGGAGAAGGAAAAGGAAGGG - Intergenic
1123613581 15:22122697-22122719 CTGAGGAGAAGGAAAAGGAAGGG - Intergenic
1124143712 15:27100893-27100915 CTGAGGACCAGGAACAAGGCAGG + Intronic
1124475521 15:30030281-30030303 CTGGGGAGAAGGGAAAATGAGGG - Intergenic
1124477420 15:30046754-30046776 CTGGGGAGGGGAAACAGGGATGG + Intergenic
1125535814 15:40440904-40440926 CTGGGGACGAGGAAGCAGGAAGG + Intronic
1125815057 15:42576708-42576730 TTGGGCAGAAGGATCAAGAAAGG + Intronic
1125826768 15:42683058-42683080 ATGGAGAAAAGAAACAAGGAAGG - Intronic
1126075527 15:44905182-44905204 GTGGGGAGATGGAAGAAGAATGG + Intergenic
1126082791 15:44982276-44982298 GTGGGGAGATGGAAGAAGAATGG - Intergenic
1126401780 15:48278832-48278854 CTTGGCAGATGGAACAATGAGGG - Intronic
1126522443 15:49611825-49611847 CTGGGCAGAAGGAAGAATGTAGG - Intronic
1127549555 15:60023388-60023410 ATGGGGAGAGGGAACAGGGTTGG + Intronic
1127747925 15:61999856-61999878 AGGGAGAGAAGGAAGAAGGAAGG + Intronic
1127800305 15:62471958-62471980 CAGGGGAGAAGGAAGAAAGGAGG - Intronic
1128372312 15:67049322-67049344 GTGGGGAGAAGGACCAGGTATGG - Intergenic
1128511313 15:68315621-68315643 TTGGGGAGAAGGAGCAGGCACGG + Intronic
1128607506 15:69047739-69047761 CAGGGGACAGGGAGCAAGGATGG - Intronic
1128638394 15:69317775-69317797 ATGGGGAGAAGGGGAAAGGAGGG - Intronic
1128846424 15:70901105-70901127 CTGGGGAACAGGAGGAAGGAGGG - Intronic
1129514147 15:76146683-76146705 CTGGGGACAAAGAAAAAGGAGGG + Intronic
1129977317 15:79833061-79833083 CTGGGGAGCTGGAGCTAGGATGG + Intergenic
1130040516 15:80402599-80402621 GTGGGGAGAAGGATCCAGAAGGG + Intronic
1130044896 15:80436013-80436035 CGGGGGGGAAGGATGAAGGAGGG - Intronic
1130064887 15:80595189-80595211 CTGGTGATAAGAAACAGGGAGGG - Exonic
1130383969 15:83395177-83395199 CTGGGGAGCAGATAGAAGGAAGG - Intergenic
1132120845 15:99174030-99174052 CTAGGGAGCAGGGACAAGAAAGG + Intronic
1132157015 15:99502858-99502880 CTGGGGTGAGGCACCAAGGAGGG + Intergenic
1132322397 15:100935595-100935617 CTGGAGAGAAGGCACCAGGAGGG + Intronic
1202985827 15_KI270727v1_random:414474-414496 CTGAGGAGAAGGAAAAGGAAGGG - Intergenic
1132606094 16:794357-794379 GTGGGGAGCAGGAGCCAGGAGGG + Intronic
1132794821 16:1714640-1714662 CTGGGGAGAAGGAAAGGTGATGG - Intronic
1133837790 16:9381916-9381938 CTGGGTATAAGGAAAAAGGAGGG - Intergenic
1134193513 16:12140456-12140478 CCGTGGAGCAGGAACAAGGATGG + Intronic
1134206120 16:12239152-12239174 CTGTGATGAAGGAAGAAGGAGGG + Intronic
1134210847 16:12275294-12275316 CTGGGGAGAGGGAAGAAGAATGG + Intronic
1134829980 16:17315096-17315118 CTGGGGAAAAGGCAGAAGGAGGG + Intronic
1135010870 16:18877442-18877464 GTGGGGAGAGGGAACGAGGAAGG + Intronic
1135044040 16:19140151-19140173 CTGGGGAGAAGAAAGAAGAAAGG - Intronic
1135317757 16:21465027-21465049 GTGGGGAGAGGGAACGAGGAAGG + Intergenic
1135370652 16:21896826-21896848 GTGGGGAGAGGGAACGAGGAAGG + Intergenic
1135441134 16:22473893-22473915 GTGGGGAGAGGGAACGAGGAAGG - Intergenic
1135671140 16:24376619-24376641 GTGGGGAGAGGGAAGAAGGCAGG - Intergenic
1135686094 16:24499430-24499452 CTGTGGAGAAGGAACAGCGAGGG + Intergenic
1135939592 16:26809746-26809768 CAAGGGAGAAGGAGGAAGGAAGG + Intergenic
1136314528 16:29444709-29444731 GTGAGGAGAGGGAACGAGGAAGG + Intronic
1136327970 16:29546477-29546499 GTGGGGAGAGGGAACGAGGAAGG + Intergenic
1136442655 16:30286478-30286500 GTGAGGAGAGGGAACGAGGAAGG + Intergenic
1137041360 16:35615818-35615840 ATGGGTAGTAGGAAGAAGGATGG + Intergenic
1137264219 16:46855477-46855499 CTGGGAAGAAGGGAGAGGGAGGG - Intergenic
1137576315 16:49602580-49602602 CTGGGCAGAAGGCACTTGGATGG - Intronic
1138189046 16:54999399-54999421 GTGGGGAGAGGGCAGAAGGAAGG - Intergenic
1138273151 16:55710376-55710398 ATGGGGAGAAGGGACAGGGTAGG + Intergenic
1138480621 16:57300699-57300721 GTGGAGAGATGGGACAAGGAAGG + Intergenic
1138988477 16:62361426-62361448 CTGGGCAGAAGAAAGAAGGATGG + Intergenic
1139824306 16:69745099-69745121 CTCAGGAGAAGAAACAGGGAAGG + Intronic
1139889401 16:70238966-70238988 GTGGGGAGAGGGAATGAGGAAGG + Intergenic
1139946354 16:70645016-70645038 AGGAGGAGAAGGAAAAAGGAAGG + Intronic
1139959000 16:70706991-70707013 CTGTGGGGCAGGAACAAGGCAGG - Intronic
1140257522 16:73349785-73349807 GAGGGAAGAGGGAACAAGGAAGG - Intergenic
1140931561 16:79632914-79632936 CTGAGGGGAAGGAACAGCGATGG + Intergenic
1141481042 16:84307097-84307119 CTGGAGAGAATGAGTAAGGAGGG + Intronic
1141527146 16:84618586-84618608 TTGGGGAGAAGGAAATAGGGAGG - Intergenic
1141673037 16:85502847-85502869 CTGGGGACCAGGAGCAAGCAGGG + Intergenic
1141875322 16:86820075-86820097 CTGGGCAGAATGAACACGGCTGG + Intergenic
1141909738 16:87050490-87050512 CTGGGGAGAACGAGAAAGGAAGG - Intergenic
1142267747 16:89072279-89072301 CTGGGGAGGGGGTACAAGGATGG + Intergenic
1142284759 16:89167233-89167255 CTGAGGCGAAGGCACAAGGGTGG - Intergenic
1142292555 16:89199682-89199704 CTGGGCAGCAGGAAAAGGGAAGG + Intronic
1142502883 17:343154-343176 GTGGGGAGCAGGAACAGGCATGG - Intronic
1142618889 17:1153225-1153247 CTAGGCAGAAGGACCAAGGAAGG + Intronic
1142716316 17:1748804-1748826 CTGTGGAGCAGGCACAGGGATGG + Intronic
1143204407 17:5132260-5132282 CCCGGGAGAAGGCACAGGGAAGG - Intronic
1143379667 17:6488150-6488172 CTGTGGGGAAGGTACAGGGAAGG - Intronic
1143723408 17:8828991-8829013 CTGGGGTGGGGGAACAAGGGCGG + Intronic
1143789446 17:9281988-9282010 GTGGGGAGAAGGCCCCAGGAGGG - Intronic
1143898532 17:10156023-10156045 CTGGGGCAATGGAACAAGTAAGG - Intronic
1143975049 17:10823441-10823463 CAATGCAGAAGGAACAAGGATGG + Exonic
1144034716 17:11354775-11354797 CTGGAGGGAAGGAACAAATAAGG - Intronic
1144191858 17:12853844-12853866 CTAGGAAGAAGGGAAAAGGAAGG - Intronic
1144313677 17:14038587-14038609 CTGAGGAGAAGGAACACTGGAGG - Intergenic
1144442164 17:15293275-15293297 CTGAGAAGATGGAAGAAGGAAGG - Intergenic
1144556402 17:16286364-16286386 CTGGGGAGAGGAAAGAAGGGGGG + Intronic
1144639658 17:16930508-16930530 CCCGGGAGAAGGCACAGGGAAGG + Intronic
1144843875 17:18205777-18205799 CTGGGGAGAAGTAAGCAGGAGGG - Intronic
1145798922 17:27671357-27671379 CCCGGGAGAAGGCACAGGGAAGG + Intergenic
1146123890 17:30217305-30217327 CTGGGGTGAAGGAGAAAGAAAGG + Intronic
1146125921 17:30231801-30231823 CTGGGCCGAAGGAACAGGGAGGG - Intronic
1146492547 17:33292782-33292804 CCAGGGAGCAGTAACAAGGAAGG - Exonic
1146947954 17:36886528-36886550 CTGGGGGAAGAGAACAAGGAAGG + Intergenic
1147118869 17:38323429-38323451 CTGGAGCTAAGGAACAAGGAGGG - Intergenic
1147141788 17:38464571-38464593 CTGGGGAGAGGGAGGAAGGAGGG + Intronic
1147543801 17:41382656-41382678 CTGGGGAGAAAGAACAGTGGCGG - Intronic
1147687249 17:42293880-42293902 CTGGGGAGAAGGAACCAAGTGGG + Intronic
1147710073 17:42457084-42457106 CTAGGGAGCAGGGAGAAGGAGGG + Intergenic
1148049186 17:44760767-44760789 CTGGGCAGAGGGAGGAAGGAGGG + Intronic
1148147294 17:45373892-45373914 CCAGGGAGAAGGGAGAAGGAGGG - Intergenic
1148845424 17:50527179-50527201 CAGGGGACCAGGAACCAGGAGGG - Intronic
1149107114 17:52982680-52982702 GAGGGAAGAAGGAAGAAGGAAGG - Intergenic
1149888390 17:60363855-60363877 TTTGGGAGAAGGAAGGAGGAAGG + Intronic
1149930594 17:60750843-60750865 CAGTGGATAAGGAACAAGAAGGG - Intronic
1150249533 17:63698374-63698396 TGCGGGAGAAGGAAGAAGGAAGG + Exonic
1150627081 17:66848695-66848717 TGGGGGAGAAGGTCCAAGGAGGG - Intronic
1150893287 17:69179588-69179610 CTGGGGAAAAGAAAGGAGGAAGG + Intronic
1151198808 17:72452684-72452706 CAGGGAAGAAGGACCAAGGAAGG + Intergenic
1151532496 17:74715613-74715635 CTGGGCATGAGCAACAAGGAGGG + Intronic
1151541872 17:74768705-74768727 TTGGGGAGAAGGAAAAAGGTGGG - Exonic
1151759118 17:76090656-76090678 AAGCGGAGAAGGACCAAGGAGGG + Intronic
1151867825 17:76816051-76816073 AGGGAGAGAAGGAAGAAGGAAGG + Intergenic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1152713307 17:81885811-81885833 CTGGAGAGAAGGCCCCAGGAAGG - Intergenic
1152979441 18:261999-262021 CTGGGGAGTGGGAACTAGAAAGG - Intronic
1153060658 18:991569-991591 CAGGGAAGGAGGAAGAAGGAAGG - Intergenic
1153226422 18:2903422-2903444 CTGGGGCGTGGGAAGAAGGATGG - Intronic
1154031245 18:10756062-10756084 ATGGGGATAAGGATAAAGGATGG + Intronic
1154147058 18:11875122-11875144 GTGGGGAGCAGGAACAGGGAAGG + Intronic
1155385751 18:25275642-25275664 ATGGGGAGAAGGAAAGAGGGAGG - Intronic
1155718336 18:28975474-28975496 CTGTGGAGCAGGGCCAAGGAGGG + Intergenic
1155739956 18:29277102-29277124 AAGGAGAGAAGGAAAAAGGATGG - Intergenic
1155998622 18:32359229-32359251 CTAGGGAGAAGGAATCAGGTGGG - Intronic
1156015985 18:32547573-32547595 CTGTGGAGAAGAAAACAGGAGGG - Intergenic
1156696919 18:39778586-39778608 CTGGGGAGAAGGAGATAGAAGGG + Intergenic
1156812284 18:41267037-41267059 TTGGGGAGAAGGGAGAAGGGTGG + Intergenic
1157051627 18:44172763-44172785 CTGGGGAAATGGAACAAGGAAGG + Intergenic
1157652067 18:49343287-49343309 CTGAGCAGAATGAGCAAGGATGG - Intronic
1158015689 18:52780763-52780785 CAGGGGAGAAGGGAGGAGGAAGG + Intronic
1158185217 18:54763742-54763764 CAGGGGAGGAGAAACAAGTAAGG - Intronic
1158355577 18:56614918-56614940 CAGGAGAGGAGGTACAAGGAAGG + Intronic
1158743275 18:60167901-60167923 CCCTGGAGAAGGAACAAGGATGG - Intergenic
1159159834 18:64629540-64629562 CTAGGGGGAAAAAACAAGGAGGG - Intergenic
1159358213 18:67364439-67364461 CATGGGAGAAGGGACAAGGAAGG + Intergenic
1159478248 18:68952480-68952502 CTGGGATAAAGGAACCAGGAAGG + Intronic
1159754742 18:72350530-72350552 GAGGGGAGAAAGAAAAAGGATGG + Intergenic
1160245367 18:77154814-77154836 GGGGTGAGAAGGAACAGGGAAGG + Intergenic
1160696454 19:487110-487132 CTGGGAAGAAGGAAAAGGCAGGG - Intergenic
1161012613 19:1967850-1967872 CTGGGGAGAAGGGAGGAGGGAGG - Intronic
1161012634 19:1967911-1967933 CTGGGGAGAAGGGAGGAGGGAGG - Intronic
1161735586 19:5990476-5990498 CTGGGGAGTAGCAAAGAGGAAGG + Intergenic
1162531431 19:11238365-11238387 CTGGGGTGATGGGACAAGGCTGG + Intronic
1162950161 19:14066703-14066725 GTGGCTGGAAGGAACAAGGATGG + Intergenic
1163161266 19:15465478-15465500 CTGGGAAGAGGGTACAAGGGGGG + Intergenic
1163839241 19:19595745-19595767 CTGGGGGGTGGGGACAAGGAGGG + Intronic
1163840084 19:19602309-19602331 CAGCGGAGAGGGAACAAGGTTGG + Intronic
1164286437 19:23821542-23821564 CTAGGGAGAAGGAACCCGGTTGG + Intronic
1164592609 19:29514496-29514518 CAGGGGATGAGGAAGAAGGAGGG + Intergenic
1164855453 19:31517372-31517394 GTGGGAAGAAGGAAGAAGGAGGG + Intergenic
1165185726 19:34019393-34019415 ATTGGGATAAGGAACATGGAGGG - Intergenic
1165586709 19:36923109-36923131 ATGGGGACAGGGAACCAGGATGG - Intronic
1165706536 19:37980225-37980247 AAGGGGAGAAGGAACAAGGTGGG - Intronic
1165920981 19:39297817-39297839 CTGGGGAGAAGGAGACAGGAGGG - Intronic
1166137039 19:40783898-40783920 CTGTGGAGAAGGGAGAAGGGAGG - Intronic
1166270505 19:41710563-41710585 CTGGGGACAGGGAACAAGTGTGG - Intronic
1166357464 19:42235622-42235644 TGGGTGAGAAGGATCAAGGAAGG - Intronic
1166589121 19:43980542-43980564 CTGGTGAGAAGGAAGCAGGAAGG + Intronic
1166645689 19:44530034-44530056 CTTGGGAGAAGGGGCAGGGAGGG + Intergenic
1166763069 19:45236532-45236554 CTTGGGAATAGGAACATGGATGG + Intronic
1166863145 19:45821172-45821194 CTGGGAGGAAGGAAGGAGGAGGG + Intronic
1166994633 19:46714329-46714351 CTGGGGAGGAGGCACAGGGGAGG - Intronic
1167560110 19:50221924-50221946 CTTGGGGGAAGGAGCAGGGAAGG - Intronic
1167611208 19:50508496-50508518 CTGGGGACAGGGGACCAGGAAGG - Intronic
1167640139 19:50676945-50676967 CCAGGTAGCAGGAACAAGGAAGG - Intronic
1167768111 19:51497551-51497573 CCGGACAGAAAGAACAAGGACGG + Intronic
1168271229 19:55250854-55250876 GTGGGGAGAGGGAACGAGCAGGG - Intronic
1168452707 19:56478208-56478230 GCGGGGAGAAGGGACGAGGAGGG + Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925745715 2:7041947-7041969 CAGAGGTGAAGGCACAAGGATGG - Exonic
926115388 2:10209981-10210003 CTGGGCAGCAGGAGCAGGGATGG - Intronic
926230751 2:11002118-11002140 CTGGGGAGGAGGAGCCAAGATGG - Intergenic
926472863 2:13282841-13282863 CTGGGGAGAAACAAATAGGAAGG + Intergenic
926659372 2:15446105-15446127 TTGGGAAGGAGAAACAAGGAAGG + Intronic
926881060 2:17543583-17543605 CTGCGGAGAAGGGAAAGGGAAGG + Intronic
926935388 2:18082618-18082640 CAGGGAACAAGGAACAAGGAAGG - Intronic
927091957 2:19719151-19719173 CTGGAGAGGGGGAACCAGGAAGG - Intergenic
927695492 2:25236887-25236909 CTGGGGGGCAGGGAGAAGGAAGG - Intronic
927963566 2:27255494-27255516 CGGGGGAGAAAGAACAGGCAGGG + Intronic
928115494 2:28542889-28542911 CTGAGTAGAAGGATGAAGGAAGG - Intronic
928340566 2:30439788-30439810 GTGGGGAGGAGGAAAACGGAGGG - Intergenic
928378541 2:30798874-30798896 CTGCTGACAAGGAACAAGGAAGG + Intronic
928620201 2:33081243-33081265 CAGGGGAGAAGGGCCAGGGAAGG + Intronic
928717843 2:34083306-34083328 CATGGGAGAAGGAAGAAGGGAGG + Intergenic
928950507 2:36809159-36809181 GTAGGGAGAAGGAACAAGGATGG + Intronic
931764069 2:65439037-65439059 GTGGGGAGTAGGAAGAAGGCTGG + Intergenic
931912919 2:66921888-66921910 TTGGGGAGTGGGAACCAGGATGG + Intergenic
932304322 2:70691051-70691073 TTGGGGAGCAGGCACAAGAAAGG + Intronic
932332641 2:70906452-70906474 CGGGGGAGATGGTTCAAGGAGGG - Intronic
932369785 2:71177503-71177525 CTGGGGAGAAGGAGAAATGCAGG - Intergenic
932369834 2:71177754-71177776 CTGGGGAGGAGGAGTCAGGAAGG + Intergenic
933737590 2:85507699-85507721 CTGGGGAGATGGACCAAAAAGGG + Intergenic
934054543 2:88240839-88240861 TTGTGGAGAAGGAAGAGGGAAGG - Intergenic
934521141 2:95020906-95020928 CAGGGCAGAAGGAACAGGCATGG - Intergenic
934745532 2:96757163-96757185 CTTGGGAGCAGGACCATGGAAGG - Intergenic
934773918 2:96925239-96925261 AAGGGGAGAAGGAACATTGAAGG + Intronic
934870478 2:97860735-97860757 GTGGGGAGAAGGGACAATGAAGG - Intronic
934991540 2:98925107-98925129 CTGGGGAGAGGCAAGAGGGAAGG + Intronic
935131652 2:100265288-100265310 CTGGGGAGAAGGAGAAGGGTGGG - Intergenic
935256360 2:101313334-101313356 TTGGGGAGAAGAAACAAGAGAGG - Intergenic
936027636 2:109045747-109045769 GAGGGGAGGAGGAAGAAGGAAGG + Intergenic
936277994 2:111117273-111117295 CAGGGAGGAAGGACCAAGGAGGG + Intronic
936532446 2:113285855-113285877 CTGGGGAGAAGGGGCAATGAGGG + Intergenic
936738943 2:115480405-115480427 CTAGGAAGTAGGAACGAGGAGGG - Intronic
936971044 2:118176585-118176607 GTGGGGAGAAGGAGCAAGGAGGG - Intergenic
936979189 2:118248675-118248697 CTGGAGAGAAAGCACAAAGAAGG - Intergenic
937779432 2:125820327-125820349 CTAGAGAGAAGACACAAGGAAGG + Intergenic
938557106 2:132435292-132435314 CTGAGGAGAACGAGGAAGGAGGG - Intronic
938630852 2:133165598-133165620 CTGGGGTGATAGAACAAGCAGGG + Intronic
938692865 2:133808271-133808293 CTGGGGACAAGGGACCAGGAAGG + Intergenic
939175776 2:138746024-138746046 GTGGGGAGAGGAGACAAGGAAGG + Intronic
939275578 2:139992832-139992854 CTGTGGAGCAGGAACAATGGTGG + Intergenic
939397913 2:141655100-141655122 CTGGGGAGGAGGAAGAGGGACGG + Intronic
939448608 2:142341957-142341979 CTGGGGAGAATGAAAAAGGATGG + Intergenic
939570279 2:143832483-143832505 CTGGGGTGAAGGAGGAGGGAAGG + Intergenic
939623246 2:144446396-144446418 ATGTGGAGAGGGAAGAAGGAGGG - Intronic
939690812 2:145258199-145258221 TTTGGGGAAAGGAACAAGGAAGG - Intergenic
940640007 2:156334690-156334712 CTGGGGAGAAGGAAGGGGGTGGG + Intronic
941256556 2:163239530-163239552 CAGAGGAGGAGGAAAAAGGAAGG + Intergenic
941754073 2:169165895-169165917 AAAGGGAGAAGGAAAAAGGAAGG - Intronic
941986243 2:171514546-171514568 CTGGGGAGAAACGACCAGGATGG + Intergenic
946049951 2:216854370-216854392 TTGGTGAAAAGGACCAAGGATGG - Intergenic
947129167 2:226903988-226904010 ATGGGGAGGTGGAAGAAGGATGG - Intronic
947228614 2:227863426-227863448 CTGGGTAGAAGGGAGAAGGAGGG + Intergenic
947291215 2:228576756-228576778 GTGGGGGGAAGGAAAAAGAAAGG - Intergenic
947654678 2:231816873-231816895 CAGAGGAGATGGAAAAAGGATGG - Intergenic
947661207 2:231869980-231870002 GTGGGGAGGAGGGAAAAGGAAGG - Intergenic
947848077 2:233261686-233261708 ATGGAGAAAAGGAACAAGGCTGG - Intronic
947852384 2:233298871-233298893 CTGGGGGGAAGCATCAAAGAGGG - Intergenic
947941894 2:234064125-234064147 AGGGGGAGAAGGAAGAGGGAGGG - Intronic
948049581 2:234969455-234969477 ATGGGCAGGAGGAACAAGGGTGG - Intronic
948544909 2:238720596-238720618 CTGGGAAGAGGGAGCAAGTATGG - Intergenic
948795941 2:240402160-240402182 CTGGGGTGCAGGGACAGGGAGGG - Intergenic
948967228 2:241392261-241392283 CTGGGGAGATACAACAAGAAGGG - Intronic
1169310640 20:4535902-4535924 ATGGGGAGAGGGAACAATGTTGG + Intergenic
1169499702 20:6147717-6147739 CTGGGGATAATGAATAAGGAAGG + Intergenic
1170767237 20:19300720-19300742 CTGGGGAGAAGAGACAAGGAGGG + Intronic
1171023674 20:21609542-21609564 CAGAGGAGAAGGATCAAGGAGGG + Intergenic
1171254953 20:23683718-23683740 CTGGGAAGCAGGAACAAGTGCGG - Intergenic
1171328000 20:24312680-24312702 CTGCTGAGGAAGAACAAGGATGG + Intergenic
1172057864 20:32166587-32166609 CTTGTGAGAAGGAAGATGGAAGG + Exonic
1172778298 20:37420646-37420668 CTGTGGGCAAGGAACGAGGAGGG - Intergenic
1172843523 20:37915968-37915990 CTGAGGAGAAAGAACAGTGAGGG - Intronic
1172890317 20:38259902-38259924 CTGGGGAGAGGGAAGAGGAAGGG - Intronic
1172980116 20:38935119-38935141 ATGGGGAGGAGGGACAAGGATGG + Intronic
1173300052 20:41794474-41794496 TTGGGGAGAAGGAAGGAGGGAGG - Intergenic
1173375867 20:42482643-42482665 CTGTGGAGAAAAATCAAGGAGGG + Intronic
1173878760 20:46394533-46394555 CTGGGGAGAAAGAATCAGAAAGG + Intronic
1174202206 20:48814579-48814601 CTGGACAGAATGAACAAGGCGGG + Intronic
1175449865 20:59054701-59054723 CTAGGGAGAAAGAACAGCGAGGG + Intergenic
1175753982 20:61517671-61517693 ATGGAGGGAATGAACAAGGAGGG + Intronic
1175921512 20:62452530-62452552 CTGAGGAGAAGGACTGAGGAGGG - Intergenic
1176155612 20:63618673-63618695 CTGGGGAGGAAGAATAAGGATGG + Intronic
1177259159 21:18706768-18706790 CTGAGGAGAGGGGAAAAGGAGGG - Intergenic
1177297366 21:19193716-19193738 CTGAGGAGGAGGAAAAAGAAGGG - Intergenic
1177360739 21:20065845-20065867 CTGGGCAGAAGGAACAGCAAAGG - Intergenic
1178719815 21:34998413-34998435 CTGAGGAGGAGGATGAAGGATGG - Intronic
1178778043 21:35571312-35571334 CTGGTGAGAAGGAAGAAGTCAGG + Intronic
1180361940 22:11908036-11908058 CTGGGAAGTAAGAACAGGGAGGG + Intergenic
1180678681 22:17607636-17607658 ATGTGGAGTAGAAACAAGGAGGG - Intronic
1180729280 22:17969535-17969557 CAGGGAAGAAGGAAGAAGGAAGG - Intronic
1180790606 22:18573691-18573713 ATGGTGAGAGGGAACAGGGATGG - Intergenic
1181175566 22:21032858-21032880 CTGGGGTGAGGGATCAAGAAGGG - Intergenic
1181231131 22:21421623-21421645 ATGGTGAGAGGGAACAGGGATGG + Intronic
1181309816 22:21938519-21938541 CCGGGGAAAAGGAACAAGGTGGG - Intronic
1181914026 22:26264918-26264940 CTTGGAAGAAGATACAAGGAAGG - Intronic
1182243220 22:28934000-28934022 TTTGGGGGAAGGAACAAAGAGGG + Intronic
1182329836 22:29543380-29543402 ATGGGGAGGAGGAAGGAGGAAGG + Intronic
1182460306 22:30478870-30478892 ATGGGGAGCTGGAACAGGGATGG - Intergenic
1182615301 22:31584555-31584577 GTGGGGAGAGGAAAAAAGGAGGG - Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182882541 22:33745893-33745915 CTGTGGAGAACTAACCAGGAGGG + Intronic
1183129040 22:35815127-35815149 CTGGGGAGAAGGCACATGGTTGG - Intronic
1183634533 22:39052954-39052976 CTGGGGAGATGGGAAAAGGCAGG - Exonic
1183775245 22:39959831-39959853 CTGGAGAGAAGGAACAAAGAGGG + Intronic
1183805836 22:40210131-40210153 TTGGGGGGAAGGCACAAGGCGGG - Intronic
1183921530 22:41173324-41173346 TTGGGGCTAGGGAACAAGGAAGG - Intronic
1184274748 22:43404028-43404050 CTGGGGAGAAGGAGCAGTGCTGG - Intergenic
1184667646 22:45997134-45997156 CTGGGGAGAGGGGACAGGAAGGG + Intergenic
1184770291 22:46593259-46593281 CCGGGGAAAAGGAACCAGGCAGG - Intronic
1184802415 22:46769630-46769652 CTGGGGAGGAGGGGCATGGAGGG + Intronic
1184950463 22:47838592-47838614 ATGGGTAAATGGAACAAGGAAGG + Intergenic
1185258599 22:49849555-49849577 CTGCGGAGAGGGAGGAAGGAAGG + Intergenic
949223094 3:1659374-1659396 CTGGGTAGAAGGCAGAAGTAAGG + Intergenic
949480110 3:4485577-4485599 CTTGAAAGAAGAAACAAGGAGGG + Intergenic
949937646 3:9128909-9128931 ATGGAGAGAGGGAACAAGCATGG + Intronic
950650770 3:14405244-14405266 CTCAGGGGAAGGCACAAGGAAGG - Intronic
951134599 3:19089880-19089902 ATGGAGGGAAGGAAGAAGGAAGG + Intergenic
951319171 3:21224269-21224291 AAGGGGAGAATGAAAAAGGAAGG + Intergenic
951412265 3:22379493-22379515 GAGGGGAGAGGGAAGAAGGAAGG + Intergenic
951564264 3:23997306-23997328 CTAGGGTGTAGGTACAAGGAGGG + Intergenic
951670891 3:25180754-25180776 TAGGGGAGAAGGAAAGAGGAAGG + Intronic
951909064 3:27730462-27730484 GTGGGGAGGAGGACAAAGGAGGG - Intergenic
952258137 3:31713240-31713262 GTGAGCAGAATGAACAAGGAGGG - Intronic
952340624 3:32442596-32442618 GTTGGGAAAAGGAACACGGAAGG + Intronic
952447908 3:33401017-33401039 CTGGGGAGAAAGGAGAAAGAAGG + Intronic
952470493 3:33645245-33645267 CTGGGTATAAGGAATAAGGCAGG - Intronic
953046471 3:39297705-39297727 CTGGGGAAATGAGACAAGGAAGG + Intergenic
953430496 3:42835878-42835900 GTGGGCAGAAGGAGGAAGGAGGG - Intronic
953552970 3:43918683-43918705 CTGGGCAGGAGGAAAAACGAAGG - Intergenic
953786866 3:45917533-45917555 CTGGGGAGAAGCATCATGGATGG - Intergenic
953997801 3:47534091-47534113 CTGGGGAGGAGGAGCCAGGCTGG + Intergenic
954205673 3:49057249-49057271 CTGGGCAGAATAAACAGGGATGG + Exonic
954396469 3:50295942-50295964 CTTGGAAGAGGGAACAAGGTGGG - Intronic
954718526 3:52539501-52539523 CTGGGGAGAAGGCACAGGACAGG + Intronic
954719362 3:52547969-52547991 GTGGGGGGAAGGAACAAAGGAGG - Exonic
955702622 3:61697078-61697100 CAGGGGAGAAGGGTCAGGGAAGG - Intronic
955887233 3:63613471-63613493 GAGGAGAGAAGGAAGAAGGAGGG + Intronic
956794356 3:72704551-72704573 TAGGGGAGAAGGAAGAAAGAAGG - Intergenic
956935513 3:74096469-74096491 CTGGGGAAAAGGAAAATGTAAGG - Intergenic
956970339 3:74516337-74516359 CTGGGGAGGAAGAAGAAGAAGGG - Intronic
957040412 3:75331768-75331790 CTGGGGAGAAGGACAAAGGAGGG - Intergenic
957062328 3:75491927-75491949 CTGGGGAGAACGAACTAGATTGG + Intergenic
957769036 3:84663935-84663957 CAGGGGAGAAGGAGAGAGGAAGG + Intergenic
958106850 3:89085442-89085464 CTGGGGAGAAAGGACAAATATGG + Intergenic
958126407 3:89361843-89361865 TTAGGGAGAAGTAACAAAGAGGG - Intronic
959027873 3:101262033-101262055 CTGAGGAGAAAGAATAAGAAAGG - Intronic
959421930 3:106138633-106138655 TTGGGAAGAAGAAATAAGGAGGG + Intergenic
960171327 3:114464973-114464995 TGGGGGAGAAGGAAAAACGAAGG - Intronic
960569611 3:119172945-119172967 CAGGGAAGAAGGAAAAAAGAAGG + Intronic
960878717 3:122323111-122323133 CTGGGGAGATTCAATAAGGATGG + Intergenic
960963113 3:123085689-123085711 CTGGGGAGAAGGAAAGGGGAAGG - Intronic
960992443 3:123320713-123320735 CCAGGGAGCAGGAATAAGGAAGG + Intronic
961106316 3:124245127-124245149 GAAGGGAGAAGGAACAAAGAGGG - Intronic
961205348 3:125077022-125077044 CTGGAGAGAAGGAAGGATGATGG + Intergenic
961340191 3:126212538-126212560 AGGGAGAGAAGGAAGAAGGAAGG + Intergenic
961345503 3:126260850-126260872 ATGGGGAGAAAGAAGAGGGAAGG - Intergenic
961383459 3:126510577-126510599 CTGGGGGCCAGGAACAAGGAGGG - Intronic
961433182 3:126897806-126897828 CTGGAGGGAAGGGACAGGGAAGG - Intronic
961448767 3:126993049-126993071 CTGGGCAGCAGGAACAGGGTAGG - Intronic
961455925 3:127023883-127023905 CTGGGGAGAAGGCCCCAGGTGGG + Intronic
961492783 3:127266776-127266798 CTGGAAAGCAGGAACAGGGAGGG - Intergenic
961574375 3:127822885-127822907 CTGGTGCGAAGGAGCAGGGAGGG + Intronic
961826522 3:129602016-129602038 CTGGTGAGAAGGAGCAATGGAGG - Intronic
962236698 3:133713026-133713048 CTAGGGAGAAGCAAGAATGATGG + Intergenic
962991432 3:140580894-140580916 GTGGGGAGAAGGAACCAGAATGG + Intergenic
963260402 3:143186421-143186443 AGGGGGAGAAGAACCAAGGAAGG + Intergenic
963315261 3:143751977-143751999 CTGGGGAGAGGGAAGAACCAGGG + Intronic
963956565 3:151260928-151260950 CTGGGGAGATGGAAACTGGAAGG - Intronic
963961119 3:151310259-151310281 CTGGGGAGAAGGAGGCAGAAAGG + Intronic
964178932 3:153859949-153859971 CTGGGGAGACTGAAGCAGGAGGG - Intergenic
964814277 3:160700494-160700516 TTGGGGGGAAGGAAGAAGGATGG + Intergenic
965338307 3:167455425-167455447 CTGGGGATAAGGGGAAAGGAAGG - Intronic
965489319 3:169317527-169317549 CTGGAGAGAGGAAAGAAGGATGG - Intronic
965694100 3:171389208-171389230 CTGGGCAGTAGGAAAAAAGATGG - Intronic
966261300 3:177982616-177982638 ATTGGGAGAAGGAGCCAGGAAGG - Intergenic
966288383 3:178324811-178324833 CTGAGGAGAATGAACAGGGGTGG + Intergenic
966355829 3:179077609-179077631 ATTGGGAGAAGAAACATGGAAGG + Intergenic
966626581 3:182023421-182023443 CTGGAAATAAGGAACATGGATGG - Intergenic
967080869 3:186048446-186048468 CTGGGGAGTGGGAACAGGGAGGG - Exonic
967523388 3:190462529-190462551 ATGTGGAGAAGAAACAAGAATGG - Intergenic
967819274 3:193826160-193826182 CTGTGGAGAAGAACCAAGCATGG - Intergenic
968810209 4:2796351-2796373 CTGGGGAGAAGAGAGAAGGTTGG - Intronic
969100652 4:4765761-4765783 CTGGGGAAAAGCAACACAGATGG + Intergenic
969563388 4:7963436-7963458 CTGGGGAGAAGGGCTGAGGATGG + Intergenic
969600146 4:8171379-8171401 CTGGGGAGAGGGAGCCAGGAGGG - Intergenic
969846366 4:9923178-9923200 CTGGGCAGGAGGCAGAAGGATGG + Intronic
970027665 4:11640577-11640599 TTGAGGAGTAGGGACAAGGATGG + Intergenic
971405959 4:26320955-26320977 CGGGGGAGAGGGACCAGGGAAGG + Intronic
971810526 4:31419829-31419851 TTAGGTAGAAGGAATAAGGATGG - Intergenic
972403123 4:38723522-38723544 CTGGGGAGAATCACCAAGGAGGG + Intergenic
972583008 4:40411877-40411899 TTGGGGAGAAGGAGCAAGAGGGG - Intergenic
972872324 4:43314630-43314652 CTGGGAATAAGTAACCAGGAAGG - Intergenic
972909408 4:43796580-43796602 AAGGGGAAAAGGAAAAAGGAAGG + Intergenic
974744559 4:66055338-66055360 ATGTTGAAAAGGAACAAGGATGG - Intergenic
974791285 4:66693262-66693284 GTGGGAAGAATGCACAAGGAAGG - Intergenic
975618619 4:76273206-76273228 CTGGAGGAATGGAACAAGGATGG + Intronic
975732790 4:77354049-77354071 CTGTGGAGAAGGAACTGGCAGGG + Intronic
975734380 4:77367145-77367167 CTGTGGAGAAGGAACTGGCAGGG + Intronic
975929879 4:79507062-79507084 CTGGGGAGAGGGAAAAAGAATGG - Intergenic
976106620 4:81625814-81625836 CTAGGCAGAAGGAACAGGAAGGG - Intronic
976794262 4:88914504-88914526 CCAGGGAGAAGGAATAAGAAGGG - Intronic
976916001 4:90375488-90375510 CTGAAGAGAAGGATCACGGATGG - Intronic
978326276 4:107560809-107560831 CTTTGGAGAAGTAACATGGAAGG - Intergenic
978556201 4:109983188-109983210 CGGGGGATAAGGAACCAGTACGG - Intronic
978655557 4:111061676-111061698 CTGGGGACAAAGAATGAGGATGG + Intergenic
979481093 4:121218589-121218611 ACGGGGAGAAGGAGGAAGGAAGG - Intronic
980073364 4:128266482-128266504 ATGGGCAGTAGGAAAAAGGACGG - Intergenic
980113643 4:128658713-128658735 AGGGGGAGAAGGGAGAAGGAGGG + Intergenic
980113649 4:128658731-128658753 GAGGGGAGAAGGGAGAAGGAGGG + Intergenic
980717460 4:136645842-136645864 CAGGGGAGAAGGTATAAGGGAGG + Intergenic
980884999 4:138752640-138752662 CTGGGGTGGAGGAGGAAGGAAGG - Intergenic
981044637 4:140253466-140253488 GTGGGGATAAGGAGGAAGGAGGG + Intergenic
981829083 4:148979610-148979632 TTGGGGAGGAGGAGAAAGGAAGG - Intergenic
982585382 4:157230590-157230612 ATGGAGGGAAGGAAGAAGGAAGG - Intronic
983842048 4:172469129-172469151 CTGGGGACAAAGAACAGGAATGG + Intronic
984276173 4:177612628-177612650 CTGGGCAAAAGGAACTGGGAAGG + Intergenic
984559322 4:181250337-181250359 ATGGGAAGAAGCAACTAGGAAGG - Intergenic
984731267 4:183070067-183070089 CAGCAGAGAGGGAACAAGGAAGG + Intergenic
985333169 4:188863389-188863411 CTGAGGAGGAGGAAGAAGAAGGG - Intergenic
986278332 5:6301459-6301481 ATGGGGAGAAGGCACAAGGGAGG + Intergenic
986307868 5:6528938-6528960 CTGGGGAGAGGGTACCTGGAAGG - Intergenic
986584017 5:9295520-9295542 CTGGGGAGAAGGACGAGTGATGG + Intronic
987418247 5:17687915-17687937 TTGAGGAATAGGAACAAGGAAGG - Intergenic
988431547 5:31124699-31124721 CTCGGGAGAAAGACCAAAGATGG + Intergenic
988457621 5:31400641-31400663 ATGGGGAGCAGGAAGGAGGAGGG - Exonic
988799114 5:34679721-34679743 CAGGTGGGAAGGAAAAAGGAGGG + Intronic
989162928 5:38409035-38409057 GTGGGGAGAACGAACACGGGAGG + Exonic
989169138 5:38457943-38457965 CTGGGGGGAGGGAAGAATGAGGG + Intronic
989494850 5:42100703-42100725 CTAAGAAGAAGGAACAAAGATGG - Intergenic
990193801 5:53290443-53290465 ATGGGGAGCTGGAACAGGGATGG - Intergenic
990756538 5:59078075-59078097 ATGGAGAGAAACAACAAGGAGGG - Intronic
991021633 5:61985495-61985517 ATGGGGAGAAAGAACTAGGGTGG - Intergenic
992140359 5:73790484-73790506 CTGGGGAGAAGAAACCAAGATGG - Intronic
992770149 5:80040054-80040076 CTGGGAAGAAGGGAGAAGAAGGG - Intronic
992856265 5:80864611-80864633 CTGTGGAGGAGGAAGAAGAAGGG + Intronic
993069013 5:83134846-83134868 CTGGGCAGAAGGAACAACTCTGG + Intronic
993135556 5:83957203-83957225 CTGAGCAGCAGGATCAAGGACGG - Intronic
994253322 5:97563085-97563107 ATATGGAGAAGGAAGAAGGAAGG + Intergenic
994501402 5:100583187-100583209 CTGAAGAGAAGGAGGAAGGAGGG + Intronic
994927452 5:106135868-106135890 CAGGCAGGAAGGAACAAGGAGGG - Intergenic
994941863 5:106333997-106334019 CTGGGGAGAAGTAAGATGAAGGG - Intergenic
995652088 5:114381042-114381064 CCAAGGAGAAGGAACAAGGAGGG - Intronic
996159034 5:120139746-120139768 ATGGGGAAAAGGAACAGGTAAGG - Intergenic
996312981 5:122127783-122127805 CTGGGGACAAGGAGCAGGGCTGG + Intergenic
996868808 5:128162180-128162202 CTAGGAAGAAGGGACAAGGTAGG + Intronic
997233703 5:132260520-132260542 CTGGAGAGAAAGAAGAAGGAAGG - Intronic
997845160 5:137279279-137279301 CAGAGGAGAAGTAACAAGAAAGG + Intronic
997989974 5:138536523-138536545 AGGGGGAGAAGGAATTAGGAAGG - Intronic
998577971 5:143337889-143337911 CTGGGGAGGAGGAACAAAATAGG + Intronic
999087060 5:148902271-148902293 CTGGGGACAAGCAAGAAAGAGGG - Intergenic
999238562 5:150114448-150114470 CTGGGCAAAAGGGACAAAGAGGG - Exonic
1000287092 5:159836265-159836287 CTGATGAGAAGGAAGAATGATGG + Intergenic
1000997799 5:167976145-167976167 CTGGGTAGATGGATGAAGGAAGG - Intronic
1001200236 5:169709283-169709305 GTGGGGAGAAGGCAGAGGGAAGG + Intronic
1001301247 5:170535311-170535333 CTTGGGTGAAGGAAAAAGGAGGG + Intronic
1002848190 6:967511-967533 CTGGGGGGAAGGATGAAGGGAGG + Intergenic
1002938946 6:1699290-1699312 GTGGGGAGAAAGAACAAGCTGGG + Intronic
1003131912 6:3402084-3402106 ATGGGGAGAAGGGTGAAGGAGGG - Intronic
1003268518 6:4587658-4587680 ATGGGGACAAGGAACATGGCAGG - Intergenic
1003334929 6:5161792-5161814 CTGAGGAGAAGGAAAGACGAAGG + Intronic
1003442414 6:6155437-6155459 GTGGGGAGCAGGGAGAAGGATGG + Intronic
1003511512 6:6785020-6785042 CTGGGGCCAAGGAACAAGATGGG + Intergenic
1003647372 6:7924709-7924731 CTGGGGAGAAGGCAAGAGCATGG + Intronic
1003709825 6:8576803-8576825 CTGGTCAGAAGAAACAAGGCTGG - Intergenic
1003939943 6:11014552-11014574 ATGGGGAGAAGGAAAAGGGAGGG - Intronic
1003940425 6:11019666-11019688 ATGGGGAGAAGGAAAAGGGAGGG + Intronic
1003963139 6:11228006-11228028 CTAAGGAGAAGGAAAAATGAGGG + Intronic
1004513664 6:16303418-16303440 CTGGAGGGAAGGAGCCAGGAGGG - Exonic
1004545426 6:16593573-16593595 CTGGAGAGAAGGCAGGAGGATGG - Intronic
1005727016 6:28659218-28659240 GTTGGGAGAAGGAGCAAGGTGGG + Intergenic
1006104837 6:31710329-31710351 CTGGGGAGAAGGAGCCATCAGGG - Intronic
1006174267 6:32112481-32112503 GTGGGGAGAAGGGAGGAGGAAGG + Intronic
1006391881 6:33763370-33763392 CAGAGGACAAGGAACAGGGAAGG + Intergenic
1006611857 6:35298774-35298796 CTGGGGGAAAGGAGCAAGGTAGG + Intronic
1007262058 6:40570856-40570878 ATGGGGAGAAGGCACAAAGGAGG + Intronic
1007275840 6:40673046-40673068 ATGGAGAGAAGGAGAAAGGAAGG - Intergenic
1007339745 6:41183249-41183271 CTGGGCAGAAGGGACACTGATGG + Intergenic
1007406419 6:41638455-41638477 AGGGAGAGAAGGAAGAAGGAAGG + Exonic
1007437304 6:41824096-41824118 CTGGGGATGAGTAACAAGGCTGG - Intronic
1008046787 6:46859358-46859380 TTTGGGAGAAGGACAAAGGAGGG + Exonic
1008123831 6:47646929-47646951 ATGGGCAGTAGGAAAAAGGATGG - Intergenic
1008970921 6:57366828-57366850 CTAGGGTGGAGGAAAAAGGAGGG + Intronic
1009159881 6:60268632-60268654 CTAGGGTGGAGGAAAAAGGAGGG + Intergenic
1010046232 6:71447308-71447330 CTGGGGAGAAGGGGCAGGGAGGG + Intergenic
1010251046 6:73707411-73707433 CTACAGAGGAGGAACAAGGAGGG + Intronic
1011565737 6:88669747-88669769 ATGGGCAGCAGGAAAAAGGATGG - Intronic
1011753115 6:90473099-90473121 CTGAGCAGAAGGAAGAGGGAGGG - Intergenic
1012427556 6:99131187-99131209 CAGGCAAGAAGGTACAAGGAGGG - Intergenic
1013715290 6:112953455-112953477 CTGGGGAGATCGAAGAAGAAGGG + Intergenic
1014293566 6:119589948-119589970 CGAGGAAGGAGGAACAAGGAAGG - Intergenic
1014470180 6:121803430-121803452 CTAGGGAGCAACAACAAGGAGGG - Intergenic
1014959399 6:127663940-127663962 CTGTGGAGAATGCAAAAGGATGG + Intergenic
1015147800 6:130006691-130006713 CGTGGGATAAGGAACAAGGGTGG - Intergenic
1015895716 6:138014569-138014591 CTGGGGCAGAGGAACAAGGGAGG + Intergenic
1016070515 6:139733067-139733089 ATGGGGAGAGGGAAGCAGGAAGG + Intergenic
1016338812 6:143038738-143038760 ATGGTAAGAAGGAAGAAGGAAGG - Intergenic
1016885032 6:148951093-148951115 GTGTGAGGAAGGAACAAGGAGGG + Intronic
1017008201 6:150043424-150043446 CTGGGGAGGGGGCAGAAGGAAGG - Intergenic
1017662126 6:156685103-156685125 CTTAGGAGAAGGAACAAGATAGG + Intergenic
1017737871 6:157380749-157380771 CTGGGGAGGAGGAAGAAGGGAGG + Intergenic
1017802621 6:157911321-157911343 CTAGGGAGAAGAAACATGGAGGG + Intronic
1017996336 6:159534577-159534599 CAGGGGAGAAGGGACAATGCTGG + Intergenic
1018093079 6:160362599-160362621 CTGGGGAGCAGCCACAGGGAGGG + Intronic
1018112551 6:160549336-160549358 CTTGGCAGAAGGTAGAAGGAGGG - Intronic
1019328885 7:453018-453040 CTGGGCAGAGGGAACAGGGCAGG + Intergenic
1019353026 7:564088-564110 GTGGGGAGACTGAACAGGGAGGG - Intronic
1020127689 7:5542012-5542034 CTGGGGACAAGGCACAGGCAGGG + Intronic
1020256251 7:6504352-6504374 GAGGGGACAAGGAACAAGGGCGG + Intronic
1021205676 7:17777021-17777043 CTGGGGATAGGGAATGAGGAGGG - Intergenic
1021368966 7:19817882-19817904 CTGGGAAGAGGGGACAAAGAGGG - Intergenic
1021785864 7:24152075-24152097 CTGGGGAGAAGGAGAAGGGATGG - Intergenic
1021849087 7:24790464-24790486 ATGGGCAGTAGGAAGAAGGATGG + Intergenic
1023340504 7:39214321-39214343 CAGGGGAGGAGGAGGAAGGAAGG - Intronic
1023548793 7:41346744-41346766 CAGGGTAGGAGGAAAAAGGAAGG - Intergenic
1024054336 7:45649991-45650013 CTGGGCAGAAGCAGGAAGGAAGG + Intronic
1024198778 7:47086140-47086162 CAGGGGAGAAGGTAGAATGAAGG + Intergenic
1024316904 7:48028574-48028596 CTTGGGAGAAGGATTAAGAAAGG - Intronic
1024829388 7:53431119-53431141 CTGGGGGGAAGGCACGAGGGGGG + Intergenic
1024982954 7:55172955-55172977 ATGAGGTGGAGGAACAAGGAAGG - Intronic
1026339722 7:69424796-69424818 CTGGGAAGAAAGGACCAGGAAGG - Intergenic
1026680224 7:72461027-72461049 ATGGAGAGAAGGAAGGAGGAAGG - Intergenic
1026981723 7:74530620-74530642 GTGGGGGGAAGGGACAATGATGG + Intronic
1027121406 7:75524844-75524866 CAGAGGAGAAGGAAGAAGGAGGG - Intergenic
1027420407 7:78012835-78012857 CTGGGGAGATGGGTCAGGGAAGG - Intergenic
1027900666 7:84110261-84110283 CTAGGGAGCAGGAGGAAGGAAGG - Intronic
1028382161 7:90211828-90211850 CAGGGGAGAAGGAAGGAGGGAGG - Exonic
1028519323 7:91712312-91712334 ATGGGAAGGAGGAAGAAGGAAGG + Intronic
1028907984 7:96176115-96176137 CTGAGGTCAAGGTACAAGGAGGG - Intronic
1029184499 7:98728838-98728860 CGAGGGAGAAGAAAAAAGGAAGG - Intergenic
1029282999 7:99448789-99448811 CTGGAGAGAAGGAACCAGCTCGG - Intronic
1030627155 7:111856711-111856733 CTGGGGAGAGGGAACCAGAGGGG + Intronic
1030701768 7:112648123-112648145 GTGGGGAGAAGGGACAGGGGAGG + Intergenic
1030927415 7:115476088-115476110 CTGGAGAGAAGAAAGAAGCAAGG + Intergenic
1031079407 7:117243622-117243644 CTGAGCAGAAGGAAAATGGAAGG + Intergenic
1031083313 7:117278754-117278776 GTAGGGAGAAGGAGCCAGGATGG - Intronic
1032246219 7:130215595-130215617 TTGGGGAGCAGGAACTAAGAAGG - Intronic
1032669641 7:134071466-134071488 TTGGGTAAAGGGAACAAGGAGGG + Intergenic
1032752991 7:134861071-134861093 CTGGGAAGGAGGAAGAAGCATGG + Intronic
1034391528 7:150791404-150791426 GTGGGGAGAAGAAAGGAGGAGGG + Exonic
1034563911 7:151898673-151898695 CTGCTGAGAAGGATCCAGGAGGG - Intergenic
1035222634 7:157415138-157415160 CTGGGCAGAGGGAACATGGCCGG - Intronic
1035339591 7:158151682-158151704 TTGGGGAGAAGGAAGAAAGAAGG - Intronic
1035519805 8:266835-266857 GTGGGGAGAGGGGACCAGGAGGG + Intergenic
1036241500 8:7085403-7085425 CTGGCAAGAAGGCACAGGGAGGG + Intergenic
1036705936 8:11046988-11047010 CTGGGGAGAAGGGAAATGGGGGG + Intronic
1037469659 8:19195020-19195042 CTGGTGGTAAGGAACATGGAAGG - Intergenic
1037596179 8:20356220-20356242 CTGGGGAGGAGGATGTAGGAGGG - Intergenic
1037719257 8:21429104-21429126 CTTGGAAGAAGGAATCAGGAAGG + Intergenic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1037910452 8:22740894-22740916 CTGGGGAGAAGGGAAAGGGCTGG + Intronic
1038301757 8:26357113-26357135 CTGGGTAGATGGGAAAAGGATGG + Intronic
1038328279 8:26588688-26588710 CAGGGGAGAAGTGACAAGGCTGG - Intronic
1038646032 8:29363183-29363205 GGGTGGAGAAGGAACTAGGAGGG - Intergenic
1039003387 8:33006936-33006958 AGGTGGAGAAGGAATAAGGAAGG - Intergenic
1039084996 8:33771169-33771191 CTTGGGAGAAGGAAAAAGGTTGG - Intergenic
1039660406 8:39455993-39456015 CTGGGGAGAGGGAAAAATGGTGG - Intergenic
1040682549 8:49830991-49831013 ATGGGAAGAAGAAAGAAGGAAGG + Intergenic
1040701321 8:50069698-50069720 CTGGGGAGAAGTCAGGAGGAAGG - Intronic
1041237958 8:55823779-55823801 CTGGGGAGGAGGAGGAAGGAAGG + Intronic
1042871094 8:73400481-73400503 ATAGTGAGAAGGAACCAGGAGGG - Intergenic
1042873833 8:73422906-73422928 CTGTGGAGAAGGGATAAGGCAGG - Intronic
1043052080 8:75396739-75396761 GTGGTGAGAAGGAAAGAGGAGGG - Intergenic
1043089378 8:75877975-75877997 ATGGGAAGAAGGAAGAAGAAAGG - Intergenic
1043151363 8:76720606-76720628 CAGGGGAGAAGGAACAAATCAGG - Intronic
1043435974 8:80236760-80236782 CTGGGTAAAAGGATCAGGGAAGG + Intergenic
1043623494 8:82227338-82227360 CTGGGGCTAAGGCACAAGCAAGG + Intergenic
1044477670 8:92647222-92647244 CTGGGGATAACGGACAAGCAAGG + Intergenic
1044820721 8:96154147-96154169 TTGGGGAGAAGGACAGAGGACGG - Intronic
1044950564 8:97431812-97431834 ATGGGGTGCAGGGACAAGGAGGG + Intergenic
1044992221 8:97806351-97806373 CTGGGGATAGAGAACAGGGAAGG + Intronic
1045322015 8:101089296-101089318 ATTGGGAGAAGGAAGGAGGATGG + Intergenic
1045500172 8:102738697-102738719 CAGTGGAGAAGCAAGAAGGAGGG + Intergenic
1045837441 8:106538834-106538856 GTGGGGAAAAGGAAAAAGTATGG + Intronic
1045841293 8:106584897-106584919 CTGGAGAGTAGGAAAAAGGGTGG + Intronic
1045844662 8:106619874-106619896 CTGGGGAGGGGTAAGAAGGATGG - Intronic
1046548465 8:115681637-115681659 CCAAGGAGAAGGAACAAGGCAGG - Intronic
1048027761 8:130602237-130602259 CTGGTCAGATGGACCAAGGAAGG - Intergenic
1048923684 8:139252329-139252351 CTGGGAGGAATGAACAAGAATGG - Intergenic
1049465895 8:142751171-142751193 CTGGGGAGAAGGGACAAGGGCGG + Intronic
1050119386 9:2292806-2292828 CTGAGAAGATGGAACGAGGAAGG - Intergenic
1050383790 9:5061957-5061979 CTGAGGAGAGGGAAAAAGAAAGG + Intronic
1051250398 9:15153013-15153035 GTGGGGAAAGGGAAAAAGGAGGG - Intergenic
1052006234 9:23352477-23352499 CTTGGCAGAAAGAAAAAGGAAGG - Intergenic
1052289305 9:26823931-26823953 GTGGGGAGCTGGAACAGGGATGG + Intergenic
1052293224 9:26867947-26867969 CTTTGGAGAAAGAACAAGTATGG + Intronic
1052917232 9:33932754-33932776 GTGGGGATAAGGAATGAGGATGG - Intronic
1053901001 9:42795535-42795557 TTTGGGAGAAGGACAAAGGAGGG - Intergenic
1054260643 9:62862028-62862050 TTTGGGAGAAGGACAAAGGAGGG + Intergenic
1054380461 9:64485472-64485494 CGGGGGTGGAGGAACTAGGATGG + Intergenic
1055160794 9:73125512-73125534 AGGAGGAGAAGGAACAAGAAGGG + Intergenic
1056275106 9:84986724-84986746 CTGGAGAGAATGGACAAGAAAGG + Intronic
1056459369 9:86794776-86794798 GTGGGGAGAAAGAATGAGGAGGG + Intergenic
1056998444 9:91485466-91485488 CTGAGGAGAAGGAAGGAGTATGG - Intergenic
1057396917 9:94688845-94688867 CTGGGGAAGAGGGGCAAGGATGG + Intergenic
1057822342 9:98342341-98342363 CTGAGCACAAGGAACAAGGAAGG + Intronic
1057825911 9:98371931-98371953 CTGGGCAGCAGGAAGAAGGAAGG - Intronic
1057844055 9:98508274-98508296 CTGGGGAGGAGGAGCCAAGATGG + Intronic
1057943257 9:99303299-99303321 CTGGGGAGGAGCAGGAAGGATGG + Intergenic
1058136524 9:101313820-101313842 CTGGGGATAAGGGAAAAGGAAGG - Intronic
1058156988 9:101526903-101526925 CTTGGGAGGAAGAACAGGGAAGG + Intronic
1058954164 9:109930186-109930208 TTGGGGAGAAGGAATGAGAAAGG - Intronic
1059111170 9:111559558-111559580 CTGGTGAGCAGGAAGAAGGAGGG - Intronic
1059486055 9:114627602-114627624 CTAGGGAGAAGGGAAAAGGGTGG + Intronic
1060100133 9:120833192-120833214 AGGGGGAGAAGGAAGAGGGAAGG + Intronic
1060313990 9:122491398-122491420 CTGAGGAAAAAGAAGAAGGAGGG + Intergenic
1060518770 9:124282249-124282271 CACGGAACAAGGAACAAGGAGGG - Intronic
1061628255 9:131855197-131855219 CAGGGAAGAAGGGACAAGGGAGG - Intergenic
1062123417 9:134846587-134846609 CTGGGGAGAAGGAACCCTGGAGG + Intergenic
1062283064 9:135760445-135760467 TTGGGGAGATGGGAGAAGGAGGG + Intronic
1062372969 9:136249535-136249557 CTGGGGAGCTGGGAAAAGGACGG + Intergenic
1062453000 9:136623348-136623370 CTGGAGAGAAGGAAGGAGAAAGG - Intergenic
1062588676 9:137263357-137263379 CGGGGGAGAAGGGAGAAGGAGGG - Intronic
1185928173 X:4170647-4170669 CTGGGGAGGAGGAAGGATGAAGG + Intergenic
1186045528 X:5532662-5532684 GAGGGGAGAAAGAAAAAGGAAGG + Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187267285 X:17746993-17747015 CTGGGATGAAAGAACAAGGCAGG - Intronic
1187352617 X:18534899-18534921 TTAGGGAGAAGGAGCGAGGAAGG + Intronic
1187479584 X:19643031-19643053 CTGGCCAGAAGGAAGAGGGAAGG + Intronic
1188269421 X:28120261-28120283 GTGGGGCTAAGGAACAAGGCTGG - Intergenic
1188380189 X:29482120-29482142 ATGAGTAGAAGGAACATGGATGG - Intronic
1188519288 X:31020108-31020130 CTGAAGAGGAGGAATAAGGAGGG + Intergenic
1188705685 X:33326768-33326790 CTGGAGAGAAGCAAGAAGGAAGG + Intronic
1189129274 X:38481416-38481438 CTGGGGAGAATGAACTAGAGAGG - Intronic
1189266218 X:39718618-39718640 CTGGGGAGAAGGGACAAGCAGGG + Intergenic
1189288037 X:39866063-39866085 CTTGGGAGAAGGCACAGGGCAGG - Intergenic
1189567648 X:42260060-42260082 CTGGGGAGGAGGAACAGATAGGG - Intergenic
1189653695 X:43218289-43218311 CAGGGGAGAAGGACAAGGGAAGG - Intergenic
1189935363 X:46062506-46062528 CTGGGGAGCAGGAATGGGGAAGG - Intergenic
1190314392 X:49140701-49140723 ATGGGCAGTAGGAAAAAGGATGG + Intergenic
1190449881 X:50568634-50568656 GTGGGGAGGAGCAACAAGAAAGG - Intergenic
1190682994 X:52844921-52844943 CTAAGGAGAAGGAACAAAGCTGG - Intergenic
1191091389 X:56626274-56626296 GTGGGGAGAAGAAAAGAGGAGGG + Intergenic
1191659542 X:63635684-63635706 CTGGGCAGAAGCCCCAAGGAGGG + Exonic
1191869983 X:65737676-65737698 CTGGGAAGAAGAAATAAGTAAGG - Intronic
1191870296 X:65739920-65739942 GTGGGGACAAGGAAAAAGGGAGG - Exonic
1192258339 X:69485454-69485476 CTGGGGAGAGGGTACACTGATGG - Intergenic
1192584634 X:72309258-72309280 CTGGGGAGCAGGAACGAGAGGGG + Intergenic
1192799903 X:74455976-74455998 CTGAAGAGAAGGAAGAAGCAAGG + Intronic
1195323120 X:103737055-103737077 ATGGGGCAAAGGAACAAGAAGGG + Intergenic
1195455506 X:105064767-105064789 CTGAGGAGGAGGAAAAGGGAAGG + Intronic
1195490257 X:105460394-105460416 ATGGGGAGAAGGAAGAATAAAGG - Intronic
1195708083 X:107752544-107752566 CTGGAGACAAAGAACAAGGAAGG + Intronic
1195804087 X:108743147-108743169 AAGGGCAGAAGGAAGAAGGAAGG + Intergenic
1195859263 X:109363794-109363816 ATGCAGAGAGGGAACAAGGAGGG - Intergenic
1196033916 X:111122351-111122373 CTTGGAAGAAGGAAAAAGGGAGG - Intronic
1196175340 X:112633933-112633955 AGGGGGAGGAGCAACAAGGAGGG - Intronic
1196305548 X:114098176-114098198 CTGGGGAGGATGAAAAATGATGG + Intergenic
1196862291 X:120039716-120039738 CTGAGGAGGAGGAGCAAGGTGGG - Intergenic
1196869637 X:120100482-120100504 ATGGGCAGTAGGAAAAAGGATGG - Intergenic
1196880811 X:120196628-120196650 CTGAGGAGGAGGAGCAAGGTGGG + Intergenic
1197422057 X:126249787-126249809 CTGGGAAGATGGGACCAGGAAGG - Intergenic
1197494303 X:127158647-127158669 CTGGGGAGAGGGAGAAAAGATGG + Intergenic
1197503403 X:127270489-127270511 AAGTGGAGAAAGAACAAGGAGGG - Intergenic
1197715442 X:129702995-129703017 CTGAGGGGAAGGGACAAGGAAGG - Intergenic
1198295948 X:135286560-135286582 CAGGAGAGAAGCAACAAGAATGG + Exonic
1198735151 X:139776576-139776598 CTTGGGGAAAGGAACAAGGAGGG - Intronic
1199547025 X:149017297-149017319 CAGAGGAGATGGAACCAGGAGGG + Intergenic
1199676636 X:150195102-150195124 GTGTGGAGCAGGAAAAAGGAGGG + Intergenic
1199693605 X:150327991-150328013 CGGGGAAGAAGGCAGAAGGAAGG - Intergenic
1200205040 X:154309588-154309610 GTGGGGAAAAGGCACAGGGAAGG - Intronic
1200224356 X:154409076-154409098 CTGGGGAGACGGAAGAAGGGAGG - Intronic
1200275377 X:154727258-154727280 CCATGGAGAAGGAACAAGTAAGG - Intronic
1200983291 Y:9281621-9281643 ATGGGCAGTAGGAAAAAGGATGG + Intergenic
1201578224 Y:15483551-15483573 ACGGAGGGAAGGAACAAGGAGGG - Intergenic
1202161558 Y:21940494-21940516 CAGGGGATGAGGAACAATGAAGG + Intergenic
1202229798 Y:22645879-22645901 CAGGGGATGAGGAACAATGAAGG - Intergenic
1202313358 Y:23550286-23550308 CAGGGGATGAGGAACAATGAAGG + Intergenic
1202557445 Y:26120309-26120331 CAGGGGATGAGGAACAATGAAGG - Intergenic