ID: 1092941252

View in Genome Browser
Species Human (GRCh38)
Location 12:13409297-13409319
Sequence TGGCTCCTTTAGCTTTAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092941252_1092941262 27 Left 1092941252 12:13409297-13409319 CCCACTTAAAGCTAAAGGAGCCA No data
Right 1092941262 12:13409347-13409369 GCTGCTGCTGGTGGAACTGTAGG No data
1092941252_1092941261 18 Left 1092941252 12:13409297-13409319 CCCACTTAAAGCTAAAGGAGCCA No data
Right 1092941261 12:13409338-13409360 GGTTTCAAGGCTGCTGCTGGTGG No data
1092941252_1092941257 5 Left 1092941252 12:13409297-13409319 CCCACTTAAAGCTAAAGGAGCCA No data
Right 1092941257 12:13409325-13409347 TGCACCCTCAGATGGTTTCAAGG No data
1092941252_1092941260 15 Left 1092941252 12:13409297-13409319 CCCACTTAAAGCTAAAGGAGCCA No data
Right 1092941260 12:13409335-13409357 GATGGTTTCAAGGCTGCTGCTGG No data
1092941252_1092941255 -3 Left 1092941252 12:13409297-13409319 CCCACTTAAAGCTAAAGGAGCCA No data
Right 1092941255 12:13409317-13409339 CCATAGCCTGCACCCTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092941252 Original CRISPR TGGCTCCTTTAGCTTTAAGT GGG (reversed) Intergenic
No off target data available for this crispr