ID: 1092941253

View in Genome Browser
Species Human (GRCh38)
Location 12:13409298-13409320
Sequence ATGGCTCCTTTAGCTTTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092941253_1092941257 4 Left 1092941253 12:13409298-13409320 CCACTTAAAGCTAAAGGAGCCAT No data
Right 1092941257 12:13409325-13409347 TGCACCCTCAGATGGTTTCAAGG No data
1092941253_1092941262 26 Left 1092941253 12:13409298-13409320 CCACTTAAAGCTAAAGGAGCCAT No data
Right 1092941262 12:13409347-13409369 GCTGCTGCTGGTGGAACTGTAGG No data
1092941253_1092941255 -4 Left 1092941253 12:13409298-13409320 CCACTTAAAGCTAAAGGAGCCAT No data
Right 1092941255 12:13409317-13409339 CCATAGCCTGCACCCTCAGATGG No data
1092941253_1092941260 14 Left 1092941253 12:13409298-13409320 CCACTTAAAGCTAAAGGAGCCAT No data
Right 1092941260 12:13409335-13409357 GATGGTTTCAAGGCTGCTGCTGG No data
1092941253_1092941261 17 Left 1092941253 12:13409298-13409320 CCACTTAAAGCTAAAGGAGCCAT No data
Right 1092941261 12:13409338-13409360 GGTTTCAAGGCTGCTGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092941253 Original CRISPR ATGGCTCCTTTAGCTTTAAG TGG (reversed) Intergenic
No off target data available for this crispr