ID: 1092941260

View in Genome Browser
Species Human (GRCh38)
Location 12:13409335-13409357
Sequence GATGGTTTCAAGGCTGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092941254_1092941260 -5 Left 1092941254 12:13409317-13409339 CCATAGCCTGCACCCTCAGATGG No data
Right 1092941260 12:13409335-13409357 GATGGTTTCAAGGCTGCTGCTGG No data
1092941252_1092941260 15 Left 1092941252 12:13409297-13409319 CCCACTTAAAGCTAAAGGAGCCA No data
Right 1092941260 12:13409335-13409357 GATGGTTTCAAGGCTGCTGCTGG No data
1092941253_1092941260 14 Left 1092941253 12:13409298-13409320 CCACTTAAAGCTAAAGGAGCCAT No data
Right 1092941260 12:13409335-13409357 GATGGTTTCAAGGCTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092941260 Original CRISPR GATGGTTTCAAGGCTGCTGC TGG Intergenic
No off target data available for this crispr