ID: 1092941391

View in Genome Browser
Species Human (GRCh38)
Location 12:13410465-13410487
Sequence GTTTAGCAGCACCATGCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092941390_1092941391 -7 Left 1092941390 12:13410449-13410471 CCAAATCAGAGTGGCTGTTTAGC 0: 5
1: 31
2: 79
3: 69
4: 123
Right 1092941391 12:13410465-13410487 GTTTAGCAGCACCATGCTGTAGG No data
1092941388_1092941391 5 Left 1092941388 12:13410437-13410459 CCAAAGGAAATGCCAAATCAGAG No data
Right 1092941391 12:13410465-13410487 GTTTAGCAGCACCATGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092941391 Original CRISPR GTTTAGCAGCACCATGCTGT AGG Intergenic
No off target data available for this crispr