ID: 1092944710

View in Genome Browser
Species Human (GRCh38)
Location 12:13441912-13441934
Sequence GAGGATCCACCAGATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092944710_1092944714 4 Left 1092944710 12:13441912-13441934 CCTTCCTCATCTGGTGGATCCTC No data
Right 1092944714 12:13441939-13441961 ATTAGAAACTCACATTCACCTGG No data
1092944710_1092944716 25 Left 1092944710 12:13441912-13441934 CCTTCCTCATCTGGTGGATCCTC No data
Right 1092944716 12:13441960-13441982 GGTTTTCCTATTAGAAACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092944710 Original CRISPR GAGGATCCACCAGATGAGGA AGG (reversed) Intergenic
No off target data available for this crispr