ID: 1092944714

View in Genome Browser
Species Human (GRCh38)
Location 12:13441939-13441961
Sequence ATTAGAAACTCACATTCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092944711_1092944714 0 Left 1092944711 12:13441916-13441938 CCTCATCTGGTGGATCCTCTTCC No data
Right 1092944714 12:13441939-13441961 ATTAGAAACTCACATTCACCTGG No data
1092944706_1092944714 12 Left 1092944706 12:13441904-13441926 CCCTTCCACCTTCCTCATCTGGT No data
Right 1092944714 12:13441939-13441961 ATTAGAAACTCACATTCACCTGG No data
1092944709_1092944714 7 Left 1092944709 12:13441909-13441931 CCACCTTCCTCATCTGGTGGATC No data
Right 1092944714 12:13441939-13441961 ATTAGAAACTCACATTCACCTGG No data
1092944704_1092944714 27 Left 1092944704 12:13441889-13441911 CCTCATTATCTCACTCCCTTCCA No data
Right 1092944714 12:13441939-13441961 ATTAGAAACTCACATTCACCTGG No data
1092944710_1092944714 4 Left 1092944710 12:13441912-13441934 CCTTCCTCATCTGGTGGATCCTC No data
Right 1092944714 12:13441939-13441961 ATTAGAAACTCACATTCACCTGG No data
1092944707_1092944714 11 Left 1092944707 12:13441905-13441927 CCTTCCACCTTCCTCATCTGGTG No data
Right 1092944714 12:13441939-13441961 ATTAGAAACTCACATTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092944714 Original CRISPR ATTAGAAACTCACATTCACC TGG Intergenic
No off target data available for this crispr