ID: 1092944716

View in Genome Browser
Species Human (GRCh38)
Location 12:13441960-13441982
Sequence GGTTTTCCTATTAGAAACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092944713_1092944716 0 Left 1092944713 12:13441937-13441959 CCATTAGAAACTCACATTCACCT No data
Right 1092944716 12:13441960-13441982 GGTTTTCCTATTAGAAACCTAGG No data
1092944712_1092944716 6 Left 1092944712 12:13441931-13441953 CCTCTTCCATTAGAAACTCACAT No data
Right 1092944716 12:13441960-13441982 GGTTTTCCTATTAGAAACCTAGG No data
1092944709_1092944716 28 Left 1092944709 12:13441909-13441931 CCACCTTCCTCATCTGGTGGATC No data
Right 1092944716 12:13441960-13441982 GGTTTTCCTATTAGAAACCTAGG No data
1092944710_1092944716 25 Left 1092944710 12:13441912-13441934 CCTTCCTCATCTGGTGGATCCTC No data
Right 1092944716 12:13441960-13441982 GGTTTTCCTATTAGAAACCTAGG No data
1092944711_1092944716 21 Left 1092944711 12:13441916-13441938 CCTCATCTGGTGGATCCTCTTCC No data
Right 1092944716 12:13441960-13441982 GGTTTTCCTATTAGAAACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092944716 Original CRISPR GGTTTTCCTATTAGAAACCT AGG Intergenic
No off target data available for this crispr