ID: 1092944805

View in Genome Browser
Species Human (GRCh38)
Location 12:13442851-13442873
Sequence ATGTGCACACAGATGACTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092944805_1092944812 3 Left 1092944805 12:13442851-13442873 CCTCTAGTCATCTGTGTGCACAT No data
Right 1092944812 12:13442877-13442899 CTCCTTAAGGGGAGAATCCTGGG No data
1092944805_1092944816 28 Left 1092944805 12:13442851-13442873 CCTCTAGTCATCTGTGTGCACAT No data
Right 1092944816 12:13442902-13442924 CAGACCTCAGAACAAACAGTGGG No data
1092944805_1092944807 -9 Left 1092944805 12:13442851-13442873 CCTCTAGTCATCTGTGTGCACAT No data
Right 1092944807 12:13442865-13442887 TGTGCACATGCCCTCCTTAAGGG No data
1092944805_1092944808 -8 Left 1092944805 12:13442851-13442873 CCTCTAGTCATCTGTGTGCACAT No data
Right 1092944808 12:13442866-13442888 GTGCACATGCCCTCCTTAAGGGG No data
1092944805_1092944815 27 Left 1092944805 12:13442851-13442873 CCTCTAGTCATCTGTGTGCACAT No data
Right 1092944815 12:13442901-13442923 TCAGACCTCAGAACAAACAGTGG No data
1092944805_1092944817 29 Left 1092944805 12:13442851-13442873 CCTCTAGTCATCTGTGTGCACAT No data
Right 1092944817 12:13442903-13442925 AGACCTCAGAACAAACAGTGGGG No data
1092944805_1092944811 2 Left 1092944805 12:13442851-13442873 CCTCTAGTCATCTGTGTGCACAT No data
Right 1092944811 12:13442876-13442898 CCTCCTTAAGGGGAGAATCCTGG No data
1092944805_1092944806 -10 Left 1092944805 12:13442851-13442873 CCTCTAGTCATCTGTGTGCACAT No data
Right 1092944806 12:13442864-13442886 GTGTGCACATGCCCTCCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092944805 Original CRISPR ATGTGCACACAGATGACTAG AGG (reversed) Intergenic
No off target data available for this crispr