ID: 1092947505

View in Genome Browser
Species Human (GRCh38)
Location 12:13470507-13470529
Sequence CCTACTATATGCCAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092947500_1092947505 0 Left 1092947500 12:13470484-13470506 CCTTGGGATGTCAATTCTGAACT No data
Right 1092947505 12:13470507-13470529 CCTACTATATGCCAGGAGGAGGG No data
1092947499_1092947505 14 Left 1092947499 12:13470470-13470492 CCTCTCTATAAAAGCCTTGGGAT No data
Right 1092947505 12:13470507-13470529 CCTACTATATGCCAGGAGGAGGG No data
1092947496_1092947505 17 Left 1092947496 12:13470467-13470489 CCTCCTCTCTATAAAAGCCTTGG No data
Right 1092947505 12:13470507-13470529 CCTACTATATGCCAGGAGGAGGG No data
1092947495_1092947505 20 Left 1092947495 12:13470464-13470486 CCTCCTCCTCTCTATAAAAGCCT No data
Right 1092947505 12:13470507-13470529 CCTACTATATGCCAGGAGGAGGG No data
1092947494_1092947505 21 Left 1092947494 12:13470463-13470485 CCCTCCTCCTCTCTATAAAAGCC No data
Right 1092947505 12:13470507-13470529 CCTACTATATGCCAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092947505 Original CRISPR CCTACTATATGCCAGGAGGA GGG Intergenic
No off target data available for this crispr