ID: 1092947783

View in Genome Browser
Species Human (GRCh38)
Location 12:13472731-13472753
Sequence CCCTCAGTAGTATCTTGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092947783_1092947790 2 Left 1092947783 12:13472731-13472753 CCAACCCAAGATACTACTGAGGG No data
Right 1092947790 12:13472756-13472778 GAGAAAAGGAGATCGGAAGGTGG No data
1092947783_1092947788 -5 Left 1092947783 12:13472731-13472753 CCAACCCAAGATACTACTGAGGG No data
Right 1092947788 12:13472749-13472771 GAGGGAAGAGAAAAGGAGATCGG No data
1092947783_1092947789 -1 Left 1092947783 12:13472731-13472753 CCAACCCAAGATACTACTGAGGG No data
Right 1092947789 12:13472753-13472775 GAAGAGAAAAGGAGATCGGAAGG No data
1092947783_1092947791 13 Left 1092947783 12:13472731-13472753 CCAACCCAAGATACTACTGAGGG No data
Right 1092947791 12:13472767-13472789 ATCGGAAGGTGGTTTTTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092947783 Original CRISPR CCCTCAGTAGTATCTTGGGT TGG (reversed) Intergenic
No off target data available for this crispr