ID: 1092950433

View in Genome Browser
Species Human (GRCh38)
Location 12:13498555-13498577
Sequence CAGGAAAGACACTCTGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092950433_1092950440 21 Left 1092950433 12:13498555-13498577 CCTCCCTCAGAGTGTCTTTCCTG No data
Right 1092950440 12:13498599-13498621 GCATTCCCAGACTGCAGTGCTGG No data
1092950433_1092950441 22 Left 1092950433 12:13498555-13498577 CCTCCCTCAGAGTGTCTTTCCTG No data
Right 1092950441 12:13498600-13498622 CATTCCCAGACTGCAGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092950433 Original CRISPR CAGGAAAGACACTCTGAGGG AGG (reversed) Intergenic
No off target data available for this crispr