ID: 1092953569

View in Genome Browser
Species Human (GRCh38)
Location 12:13529497-13529519
Sequence AAGAGTAAACAGAAGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092953569_1092953573 2 Left 1092953569 12:13529497-13529519 CCCACTTCCTTCTGTTTACTCTT No data
Right 1092953573 12:13529522-13529544 CCATAGCATTGATTACTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092953569 Original CRISPR AAGAGTAAACAGAAGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr