ID: 1092954481 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:13537136-13537158 |
Sequence | TGGATAGGTTTCCCTAACTG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 95 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 7, 4: 87} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1092954478_1092954481 | -3 | Left | 1092954478 | 12:13537116-13537138 | CCAGGCAAAGAACATCAATGTGG | 0: 1 1: 0 2: 0 3: 12 4: 150 |
||
Right | 1092954481 | 12:13537136-13537158 | TGGATAGGTTTCCCTAACTGAGG | 0: 1 1: 0 2: 0 3: 7 4: 87 |
||||
1092954476_1092954481 | 23 | Left | 1092954476 | 12:13537090-13537112 | CCTGGAAGAGGGGAAGGGACTAA | 0: 1 1: 0 2: 0 3: 23 4: 253 |
||
Right | 1092954481 | 12:13537136-13537158 | TGGATAGGTTTCCCTAACTGAGG | 0: 1 1: 0 2: 0 3: 7 4: 87 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1092954481 | Original CRISPR | TGGATAGGTTTCCCTAACTG AGG | Intergenic | ||