ID: 1092954481

View in Genome Browser
Species Human (GRCh38)
Location 12:13537136-13537158
Sequence TGGATAGGTTTCCCTAACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092954478_1092954481 -3 Left 1092954478 12:13537116-13537138 CCAGGCAAAGAACATCAATGTGG 0: 1
1: 0
2: 0
3: 12
4: 150
Right 1092954481 12:13537136-13537158 TGGATAGGTTTCCCTAACTGAGG 0: 1
1: 0
2: 0
3: 7
4: 87
1092954476_1092954481 23 Left 1092954476 12:13537090-13537112 CCTGGAAGAGGGGAAGGGACTAA 0: 1
1: 0
2: 0
3: 23
4: 253
Right 1092954481 12:13537136-13537158 TGGATAGGTTTCCCTAACTGAGG 0: 1
1: 0
2: 0
3: 7
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092954481 Original CRISPR TGGATAGGTTTCCCTAACTG AGG Intergenic