ID: 1092954796

View in Genome Browser
Species Human (GRCh38)
Location 12:13540009-13540031
Sequence TTGTTTCAGAATAATACATG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 325}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092954795_1092954796 -6 Left 1092954795 12:13539992-13540014 CCATATAATTATGGGATTTGTTT 0: 1
1: 0
2: 1
3: 44
4: 448
Right 1092954796 12:13540009-13540031 TTGTTTCAGAATAATACATGAGG 0: 1
1: 0
2: 2
3: 39
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092954796 Original CRISPR TTGTTTCAGAATAATACATG AGG Exonic
901519721 1:9774267-9774289 GTGTTTAAGAATAATCCATCCGG + Intronic
902074516 1:13772992-13773014 GTAATTCAGAATAACACATGAGG + Intronic
904227753 1:29038172-29038194 TTATTTCAAAATAAAACATGAGG + Intronic
905123463 1:35700469-35700491 TTGTTTAAAAATAAGACAGGAGG - Intergenic
910919122 1:92324706-92324728 TTCTTTCAGATTTTTACATGGGG + Intronic
911219244 1:95229782-95229804 TTGATTCAAAATAATATAGGAGG - Intronic
911766275 1:101678918-101678940 TCTTTTCAGCATAATATATGAGG + Intergenic
913557680 1:119984814-119984836 TTATTACAGGAGAATACATGGGG + Intronic
915933500 1:160075909-160075931 TTGTCTCAGAATAATGCCAGAGG + Intergenic
915991317 1:160519854-160519876 ATGTTTTAGAATAATAGAAGTGG + Intronic
918193921 1:182203538-182203560 TTATTTCTGAATAATAAATGTGG + Intergenic
918834815 1:189448486-189448508 TTATTTCAGAATAATAAAAAAGG - Intergenic
918881830 1:190134142-190134164 ATGATACATAATAATACATGAGG + Intronic
919224665 1:194680986-194681008 TTATTTGAGAATAAGAAATGAGG - Intergenic
920782329 1:209006055-209006077 TTGTATCAGATTAATTCCTGTGG - Intergenic
921301759 1:213757802-213757824 TTGTTTCAGGCTAATGCATCTGG + Intergenic
922628706 1:227081778-227081800 TTGTTCCCGAATAGTACAGGAGG - Intronic
923197734 1:231684500-231684522 TTGTTTGAGAATAATACAGTAGG + Intronic
923201297 1:231714860-231714882 TTGTTTCAAATGAATCCATGTGG - Intronic
924221871 1:241885516-241885538 TTGTTTCAGAATAAGAAACAAGG - Intronic
1063887715 10:10596397-10596419 TTGTCTCAGAATTGCACATGTGG + Intergenic
1064453784 10:15467800-15467822 TCCTTTCAGAATATTACCTGTGG - Intergenic
1065457085 10:25918015-25918037 TTTTTTTAGAACAACACATGAGG - Intergenic
1067252861 10:44602429-44602451 TTTTTTAAGATTAATAAATGTGG + Intergenic
1068165252 10:53322803-53322825 TTATTTCACAAGAATAAATGTGG + Intergenic
1068355670 10:55905998-55906020 TTATTTCAGAATAATAGAAAAGG - Intergenic
1069329601 10:67276684-67276706 TTGCTTCAAAATAATATGTGAGG + Intronic
1071560006 10:86638381-86638403 TTGCTTCAAAACAATACATTTGG - Intergenic
1072246871 10:93551598-93551620 TTTTTTCAAAAATATACATGTGG + Intergenic
1072640343 10:97206764-97206786 TTGTTTCGGCATCATACATTTGG - Intronic
1073786176 10:106892277-106892299 TTGTTTACGAATAAGACAAGTGG - Intronic
1074156655 10:110805898-110805920 TTGCTTCAAAATAATATAGGGGG + Intronic
1074265307 10:111896360-111896382 TTTATTCAGCATAATATATGTGG - Intergenic
1075163362 10:120043749-120043771 TTGATTCAAAATAATTCAGGGGG - Intergenic
1075499112 10:122955707-122955729 TTGATCCACATTAATACATGTGG + Intronic
1079124141 11:17707151-17707173 TTGCTTCAAAATCATACAAGGGG + Intergenic
1079169492 11:18078945-18078967 CTGATTAAGAATAATACTTGAGG - Intronic
1079504557 11:21139000-21139022 TTTTGTAAGAATAATACAAGTGG + Intronic
1079585649 11:22123892-22123914 TTGTTACAAAAGAATACCTGAGG + Intergenic
1080002499 11:27365291-27365313 TTGCTTCAAAATAATGCAAGGGG + Intergenic
1080337214 11:31211329-31211351 TTGTTTCTGATAAATACATATGG - Intronic
1084058904 11:66656575-66656597 TTGTTTGAAAATAATACTTCAGG - Intronic
1086200179 11:84193166-84193188 TTGTTGAATAATAATAAATGAGG + Intronic
1087073855 11:94110322-94110344 TTGATTCAGAATCTTTCATGAGG + Intronic
1087086464 11:94223724-94223746 TTTCTTCACAATAATCCATGGGG - Intergenic
1088022490 11:105136599-105136621 TTGTCTCGGAATAATACACAGGG - Intergenic
1090529926 11:127579822-127579844 TTGTTTTAGAACCATACAAGTGG + Intergenic
1090583572 11:128185787-128185809 TTGGTTCAAAATAAAACATGAGG + Intergenic
1090693703 11:129214677-129214699 TTGTTTCAAATTGATACATGAGG + Intronic
1090806455 11:130205505-130205527 ATGGTTCTGAAAAATACATGCGG - Intronic
1092954796 12:13540009-13540031 TTGTTTCAGAATAATACATGAGG + Exonic
1093303877 12:17488072-17488094 TTGTTTTAGAAGAATGCATATGG + Intergenic
1094060507 12:26310406-26310428 TTGTTTCATAGATATACATGTGG + Intergenic
1097713637 12:62941728-62941750 TTGTTTTTGAATAAAATATGAGG - Intergenic
1097788240 12:63784652-63784674 TCATTTCAGAATAAGACAGGTGG + Intronic
1098729645 12:74016915-74016937 TTGTTTCAAAATAAAATCTGTGG + Intergenic
1099197406 12:79633927-79633949 TTGCTTCAAAATAAGACAAGAGG + Intronic
1099782286 12:87211648-87211670 TTTTTTCAGAAAAATACCAGTGG + Intergenic
1100094071 12:91009838-91009860 TTGACTCAGAATAAAACATGAGG - Intergenic
1103589543 12:121981530-121981552 TTGCTTCAGAATAACCCATGGGG - Intronic
1105231783 13:18503071-18503093 TTGTTCCAGAATCCTACGTGAGG + Intergenic
1105563927 13:21524348-21524370 TTGTTTCAAAATAATCCAGTGGG - Intronic
1106355711 13:28981244-28981266 TTGTTTGAGATTAATCCATGTGG - Intronic
1106452729 13:29897773-29897795 TTGTTTCAGTAATATACATATGG + Intergenic
1107471842 13:40698287-40698309 TTGTTTCAAAATAATCCAGGAGG - Intergenic
1108109072 13:47047794-47047816 GAGTTTCAGAATAATGAATGTGG - Intergenic
1108139602 13:47406256-47406278 TTGTTTCTGAAAAATAGAGGGGG - Intergenic
1108306804 13:49144698-49144720 TTGTGACAGAAAAAAACATGTGG - Intronic
1108900349 13:55396692-55396714 TTATTTCAGAATAATTAATAGGG - Intergenic
1109727228 13:66358266-66358288 TTGTTTCAGTATAGTACCTTTGG + Intronic
1111563790 13:89988455-89988477 TACTTTCAGACTAATTCATGTGG + Intergenic
1112182912 13:97103019-97103041 TTGCTACAGAGTAATACTTGAGG + Intergenic
1112185219 13:97121568-97121590 TTCTTTAAGAATACTACATGAGG - Intergenic
1112454358 13:99544915-99544937 TAGTTTCAGAACAATCCCTGTGG - Intronic
1114015237 14:18422551-18422573 GTGTTCCAGAATACTACGTGAGG + Intergenic
1115097749 14:29658490-29658512 TTTTTTCAGAATATTTTATGGGG + Intronic
1115159677 14:30379743-30379765 TTGCTTCAAAATAATACTTCGGG + Intergenic
1116941277 14:50793314-50793336 GTGTTTCAGACTAATTGATGTGG - Intronic
1117048885 14:51840905-51840927 TTGTTGTAGCATTATACATGAGG - Intronic
1118784668 14:69036208-69036230 TTGTTTCAAAATAATAGAAAGGG + Intergenic
1120033218 14:79666336-79666358 TTGTCCCAGCATTATACATGTGG - Intronic
1120133800 14:80839741-80839763 TTTTTTAAAAATTATACATGTGG + Intronic
1120350885 14:83356775-83356797 TGATTTCAGAATAAAACAAGTGG - Intergenic
1120389128 14:83882858-83882880 TTGCTTGAAAATAATAAATGGGG - Intergenic
1121840011 14:97126001-97126023 TTGTTTCAAAAAAATAGTTGTGG + Intergenic
1202933605 14_KI270725v1_random:62964-62986 TTGTTTTAGAAAAAAACATTTGG + Intergenic
1124682154 15:31741249-31741271 TTGCTTCAAAATAATATAGGAGG + Intronic
1124824322 15:33078451-33078473 TTTCTTCAGAATATTTCATGAGG - Intronic
1126334064 15:47566897-47566919 TTATTTAAGAATAAAACAAGAGG + Intronic
1126409439 15:48356802-48356824 TTGTTTCAAAATAATTCACTGGG - Intergenic
1127431166 15:58910175-58910197 TTGTTTCAAAATAATGCAGAAGG + Intronic
1128768933 15:70267483-70267505 TTGCTTCAGAATTATAGCTGTGG - Intergenic
1129570670 15:76680869-76680891 TTGCTTCAGAAGAACACCTGAGG - Intronic
1130208440 15:81900498-81900520 CTTTTTCAGAATAAGACTTGAGG + Intergenic
1130675194 15:85946260-85946282 TTGCTTCAAAATAATCCAGGAGG + Intergenic
1131030464 15:89182116-89182138 TTTTTTGAGAATAATCCATAAGG - Intronic
1131218022 15:90556300-90556322 TGGTTTCAGAATTCTACTTGTGG - Intronic
1132328658 15:100994956-100994978 TTGGTTCAGAATATTACACAAGG + Intronic
1138726542 16:59146600-59146622 TTGGTTCTGAAAAATACTTGAGG + Intergenic
1140199424 16:72882361-72882383 TTGTTTCAGCATATGACACGTGG - Intronic
1140583708 16:76261877-76261899 GGGTTTAATAATAATACATGTGG - Intergenic
1140934537 16:79658241-79658263 TTGTTTCAGAACATTCCTTGCGG + Intergenic
1203065872 16_KI270728v1_random:1017111-1017133 GTGTTTCAGAAGAATGAATGTGG + Intergenic
1146152943 17:30492267-30492289 TTCTTTCACAATAATATATGTGG - Intronic
1149963935 17:61142715-61142737 TTGCTTCAAAATAATAGAGGAGG + Intronic
1150026601 17:61681558-61681580 TGGTTTAAGAATAATACCAGAGG + Exonic
1150186271 17:63184930-63184952 TAGTTTCAAAAGAATACATAGGG - Intronic
1150880605 17:69021948-69021970 TTGTTTCTGATTAGTACATTTGG - Intronic
1155704916 18:28797302-28797324 TTATTTCTGGATAAAACATGTGG + Intergenic
1155785951 18:29899692-29899714 TTGTTTTATATTAATGCATGTGG + Intergenic
1156107150 18:33676818-33676840 TTGTCTCAGAAAACTTCATGGGG - Intronic
1157971386 18:52273658-52273680 TTATTTCAGTACAATACATTTGG + Intergenic
1159413027 18:68105841-68105863 ATGTTTCAGACTATCACATGGGG + Intergenic
1159477566 18:68942867-68942889 ATGTTTCAGACTATCACATGGGG + Intronic
1160171267 18:76557477-76557499 GTGTATCAAAATAATAAATGCGG + Intergenic
1167883840 19:52484448-52484470 ATATTTCAGAATATCACATGGGG + Intronic
925629864 2:5880904-5880926 TTGTTTCAAAATAACATATTTGG - Intergenic
925747698 2:7057594-7057616 TGGTATAAGAATAATAGATGAGG + Intronic
928059632 2:28098295-28098317 TTTTGTCAGAATTATAAATGGGG + Intronic
928326961 2:30326955-30326977 TTGTTTCAGGATAATACGGGGGG - Intergenic
928535464 2:32235839-32235861 TTGCTTTAGAATAATACAGGAGG - Intronic
928541574 2:32289503-32289525 TTATTTCAGAAAAATACTTTTGG - Intronic
929497554 2:42459330-42459352 TTATTTCAAAATAAGACATGAGG - Intronic
930256696 2:49101584-49101606 ATGGTTCAGAATAACATATGAGG + Intronic
930519632 2:52448733-52448755 TTGAATCAAAATAATGCATGAGG + Intergenic
930980381 2:57518538-57518560 TTTTTTCAGAATTACAGATGAGG - Intergenic
932215210 2:69961868-69961890 GTGTTCCAGAATAACAGATGAGG + Exonic
932964393 2:76454606-76454628 CTGTCTCAGAATAAAACATTAGG - Intergenic
933221042 2:79688850-79688872 TAGTTTCAGAACACTACATTTGG - Intronic
933349114 2:81130266-81130288 TAGTTCCAGAATTATACATTTGG - Intergenic
934917200 2:98309857-98309879 TTGTTCCAGCATAAGAAATGGGG - Intronic
935322565 2:101903064-101903086 TTGTTTCAAACTAAGCCATGAGG - Intergenic
938022053 2:127913925-127913947 TTATTTCATACTAATAAATGAGG - Intergenic
939419932 2:141953635-141953657 TAGTTTGAGAATCATACATAGGG + Intronic
939475822 2:142685552-142685574 ATGTTTCAGAATCATCCTTGAGG - Intergenic
939940650 2:148347008-148347030 TTGCTTCAGAATAATACAGGGGG - Intronic
940774130 2:157868993-157869015 TTATTTCTGAACAATATATGGGG + Intronic
941073109 2:160976928-160976950 TTATTTCAGATTTATAGATGAGG + Intergenic
941099400 2:161280390-161280412 TTTTTTCAGAAAAATACAATGGG - Intergenic
941398968 2:165007172-165007194 TTGTCTCTTAATAATTCATGAGG + Intergenic
941522156 2:166559468-166559490 TTGATTCAGAAAAATAACTGTGG - Intergenic
941862225 2:170295378-170295400 TAGTTTCAAAATGATAGATGGGG - Intronic
941887577 2:170544620-170544642 ATATTTCAGAAAAATAGATGAGG - Intronic
942510487 2:176694051-176694073 TTGTTTCATATTCATACATATGG - Intergenic
944053879 2:195502946-195502968 TTGTTAAAGAATAAGACATAAGG - Intergenic
944796909 2:203196388-203196410 TCTTTTCATATTAATACATGGGG - Intronic
944851558 2:203724987-203725009 TTGTTTTAGAAAAATTCTTGAGG + Intronic
945232025 2:207601679-207601701 ATATTTCAGTATATTACATGTGG - Exonic
947939043 2:234032957-234032979 TGATTTAATAATAATACATGGGG + Intergenic
949088001 2:242173764-242173786 TTGTCTCACAATGATACTTGGGG - Intergenic
1169966898 20:11227824-11227846 TTGTTTCTGAATCATAAATTTGG + Intergenic
1170007888 20:11688183-11688205 TTGATTTAGAGAAATACATGAGG - Intergenic
1170430453 20:16271137-16271159 CTGATTCTGAATAAAACATGAGG - Intergenic
1170472158 20:16678967-16678989 TTGGTTCAAAATTATACAAGAGG + Intergenic
1170628999 20:18052470-18052492 TTGCTTCAGAATCATGCATGGGG + Intronic
1171200427 20:23236583-23236605 CTGTTTCAGAAAAACACATCTGG + Intergenic
1171817893 20:29804770-29804792 ATATTTCAGAATATCACATGCGG - Intergenic
1172364748 20:34340420-34340442 TTATTTCAAAATAATACAAATGG - Intergenic
1173434520 20:43020744-43020766 TTGCTTCAGAATATGTCATGGGG - Intronic
1173506811 20:43593947-43593969 GTGTTTCAGAATAATGCATATGG + Intronic
1174440209 20:50545501-50545523 CTTTTTCAGACTAATCCATGAGG - Intronic
1174491913 20:50905461-50905483 TTGGATTAGAATAATAAATGAGG - Intronic
1174737584 20:52980108-52980130 TTGTTTCAGAAAACCAAATGTGG + Intronic
1176766486 21:13024090-13024112 ATATTTCAGACTATTACATGGGG - Intergenic
1176864739 21:14040483-14040505 TTTTTTCATGATACTACATGAGG + Intergenic
1177009754 21:15717678-15717700 TTGTTTCAAAATAACACAACAGG + Intergenic
1177341610 21:19810463-19810485 CTGTTTTGGAGTAATACATGGGG - Intergenic
1180321339 22:11324252-11324274 GTATTTCAGAATATCACATGGGG - Intergenic
1180439738 22:15353328-15353350 GTGTTCCAGAATACTACGTGAGG + Intergenic
1182765593 22:32755786-32755808 TTGTTTCAACATAGTACAAGGGG - Intronic
1183986102 22:41571532-41571554 TTGTTTCAGAGTCACACATCTGG - Intronic
951565820 3:24011624-24011646 TTGTGGCTGAGTAATACATGAGG - Intergenic
955630684 3:60970940-60970962 TTGTTTTAAAATAATATATTTGG - Intronic
956573518 3:70724846-70724868 TTGTTTCACTCTAATGCATGTGG + Intergenic
957949117 3:87101612-87101634 TAGTTCCAGAATAACACATCAGG - Intergenic
958619705 3:96542289-96542311 TTCTACCAAAATAATACATGTGG + Intergenic
958806244 3:98814257-98814279 TTATTTCAGAGTAATATCTGAGG - Intronic
959224935 3:103568299-103568321 TTATGTCAGAACAATACTTGGGG + Intergenic
959645340 3:108693194-108693216 TTGTTTTTGAATAAAATATGAGG + Intronic
959783674 3:110267395-110267417 CTGTTTCAGAAAAACATATGTGG - Intergenic
959855193 3:111146095-111146117 CTCTTTCAGTATAATACTTGTGG + Intronic
960382755 3:116984732-116984754 AGGTTTAAGAAAAATACATGGGG + Intronic
962100610 3:132338499-132338521 TAGTTTCACAAGAATACCTGTGG + Intronic
962151689 3:132900467-132900489 TTATTTCAGAGTAATACAGTGGG + Intergenic
963173793 3:142278005-142278027 TTCTTTAAAAATAATAGATGTGG + Intergenic
963316936 3:143769466-143769488 TTGTTTCAGAGGAATACTTTAGG - Intronic
963969755 3:151416433-151416455 TTGTTTTGGAATCAGACATGTGG + Intronic
964806645 3:160617512-160617534 TTGCTTTAAAATAATCCATGAGG - Intergenic
965457956 3:168927974-168927996 TTGTTTGAGAAAAAAAGATGAGG + Intergenic
965950036 3:174297750-174297772 TTATTTCACAATAATTCATTCGG - Intergenic
966995922 3:185280522-185280544 TTATTTTAAAATAATACACGAGG - Intronic
967052583 3:185798463-185798485 TTGTGTAAGAAAAATTCATGTGG - Intronic
967585203 3:191205079-191205101 TTGTTTCCTAAAAATATATGAGG - Intronic
968683749 4:1941411-1941433 TTGATTTAGAGTAATGCATGAGG + Intronic
968881781 4:3304258-3304280 TAGTTTTTGAATAATACATTAGG - Intronic
969065468 4:4476753-4476775 TTGCTTCACAATAAGACAGGGGG + Intronic
970815160 4:20146459-20146481 TTGTTACATAATTATACATATGG - Intergenic
971088693 4:23312999-23313021 TAATTTCAGCATAATACATTAGG - Intergenic
971409975 4:26359810-26359832 TCGTTTCAGATTATTATATGAGG + Intronic
972139300 4:35937017-35937039 TTTTTTCAGAATATTTCATAAGG + Intergenic
972667207 4:41178159-41178181 TTGTTTAATATTGATACATGTGG - Intronic
973069454 4:45838812-45838834 ATGTATAAGAATAATCCATGTGG + Intergenic
973754433 4:54060500-54060522 TTGTATCAGAATCAAACTTGGGG - Intronic
975591963 4:76009953-76009975 TTCTTTTTGAATAAAACATGTGG + Intergenic
975960757 4:79901593-79901615 TGGTTTCAGGATAATTCAAGTGG + Intronic
977476712 4:97519755-97519777 TTATTTCAGAAAAAAAAATGAGG + Intronic
977983017 4:103348498-103348520 TGGGTTAAGAATAATTCATGTGG - Intergenic
978896007 4:113888432-113888454 TTGCTTTTGAATAATACATAAGG - Intergenic
978979522 4:114925396-114925418 TTGTTTCAGGTTATTTCATGTGG + Intronic
979878277 4:125921563-125921585 TTGTATCATAAGAATAAATGGGG + Intergenic
981175528 4:141678525-141678547 CTGCTTCAGAAAAATCCATGGGG - Intronic
981648612 4:147029034-147029056 TTGTTTCAGAATAAAGCAAAAGG - Intergenic
981649452 4:147039441-147039463 TTGTTTCCGAATAGCACAAGTGG - Intergenic
982266860 4:153545707-153545729 TTTTTTCAAAATAAGACATGTGG + Intronic
982379821 4:154738249-154738271 TTGTCTCATAATAATAAATTAGG + Intronic
983154437 4:164328828-164328850 TTGTTTAAAAATATTTCATGTGG - Intronic
983244551 4:165273261-165273283 TTGCTTCAAGATAATACAAGAGG - Intronic
983879793 4:172920056-172920078 TTGTGTCAGTATAAAAAATGTGG - Intronic
984091757 4:175383865-175383887 TTGTTCCAGAAAAATAGATGAGG + Intergenic
984235234 4:177149193-177149215 TTATTTCAGCTTAAGACATGTGG + Intergenic
984872050 4:184334307-184334329 TTATTTGAGAATAAGACATGGGG + Intergenic
986085347 5:4439182-4439204 TTGTTTCATAATTTCACATGAGG + Intergenic
986504819 5:8438888-8438910 TTGTTACAGCAGAATACCTGAGG + Intergenic
986840350 5:11689294-11689316 TTGTTACAGAATAAATAATGTGG + Intronic
987196516 5:15532399-15532421 TTGATTCAGAATAACAGATGCGG - Intronic
987604655 5:20116859-20116881 TTTTTCCAGAAAAATCCATGTGG + Intronic
987674120 5:21052006-21052028 TTGTGTCAGAATAATAGATTTGG + Intergenic
987739738 5:21891798-21891820 TTGTTTCAAAATAATTAATAAGG - Intronic
987770659 5:22299329-22299351 TTGTCTCTGAATAAAAGATGGGG + Intronic
987936038 5:24466116-24466138 ATATTTCAGACTATTACATGGGG - Intergenic
988020295 5:25613287-25613309 ATGTCTCAGAAAAATACAGGTGG + Intergenic
988100932 5:26676679-26676701 TTATTTCAAAATCATACTTGTGG + Intergenic
989095061 5:37774380-37774402 TTGTTTCACAATAATATGAGTGG - Intergenic
989221255 5:38968052-38968074 GTGTTTCATAAAAATAAATGAGG - Intronic
989235614 5:39145022-39145044 TAGTTTCAAAATAATATAAGAGG + Intronic
989514313 5:42324163-42324185 TCCTTTCAGAATTATGCATGTGG - Intergenic
989721079 5:44529165-44529187 TTTTTTCAGAATAATGCATTTGG - Intergenic
990339925 5:54812470-54812492 TTGATTCAAAATAATCTATGGGG - Intergenic
990402265 5:55450887-55450909 TTCTTTCAGAATAATACAGAAGG + Intronic
992310465 5:75493278-75493300 TTGCTTCAGAATAATGCCTTTGG - Intronic
992849999 5:80797466-80797488 TTTTTTCAGGATATTATATGGGG + Intronic
993124268 5:83813247-83813269 TTGTTACAGAATAATGCAGCTGG - Intergenic
994790161 5:104214582-104214604 TTGTTCCAGAAGACTTCATGAGG - Intergenic
995289338 5:110432323-110432345 TTCTTTCAGAATGCTAAATGTGG - Intronic
995891848 5:116962625-116962647 CTCTTGTAGAATAATACATGTGG + Intergenic
996403399 5:123086255-123086277 TTGTTCCAGAGGAATAAATGAGG - Intergenic
997371250 5:133362350-133362372 TCGTTTCAGGGCAATACATGGGG + Intronic
997489219 5:134259046-134259068 TTACTTCAAAATAATACAAGAGG + Intergenic
998485161 5:142495655-142495677 TTTTATCAGAATGAGACATGGGG - Intergenic
998962935 5:147508428-147508450 TTAGTGCAGAATAATACATGCGG + Intronic
998993340 5:147843313-147843335 TTATTTCACAATACAACATGGGG - Intergenic
999041980 5:148424136-148424158 TAGTTTCAGAATGATGAATGTGG - Intronic
1000114216 5:158138106-158138128 TTGTTTCACAAGAATGAATGGGG + Intergenic
1001725857 5:173899278-173899300 TTGCTTCAAAATAATACAAATGG - Intronic
1002509968 5:179708687-179708709 TTCTTTCAAAATAATGCATTAGG - Intronic
1004243932 6:13954145-13954167 TTGTTTCAAAATAATCCAATGGG - Intronic
1005534844 6:26745021-26745043 ATATTTCAGAATAGTACATGGGG - Intergenic
1006255897 6:32832052-32832074 TTGCTTCAGAATAATATGGGTGG + Intronic
1007617647 6:43190459-43190481 TGGTTATAGAATAATACATATGG + Intronic
1007882563 6:45183835-45183857 TTGTATCAGAATCATACAGTAGG - Intronic
1008150212 6:47941019-47941041 TTGTTTCAGAACAATTGATATGG - Intronic
1008700981 6:54099038-54099060 TTATATCAGAAGAATAAATGTGG - Intronic
1008788069 6:55194864-55194886 TTGTTTTATAACAATACAAGAGG - Intronic
1009193301 6:60655361-60655383 ATATTTCAGACTATTACATGGGG - Intergenic
1009337037 6:62504371-62504393 TTGTTTCAAATTAAGAAATGAGG - Intergenic
1009616751 6:66018847-66018869 TAGTCTCAGATTAATACATATGG + Intergenic
1009792173 6:68417904-68417926 TTGATCCAGAAAAATTCATGTGG + Intergenic
1009812748 6:68689835-68689857 TTGTTTCAGAATAAGGTATTTGG - Intronic
1012009473 6:93764009-93764031 TAGGTTCAGAATTATCCATGAGG - Intergenic
1012596345 6:101045905-101045927 TTCTTACAGAATAAGGCATGGGG - Intergenic
1012753577 6:103193422-103193444 TTGTTTTAAAGGAATACATGAGG + Intergenic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1014524539 6:122486320-122486342 TTCTTTCAGAATAATAAGTATGG + Intronic
1014633723 6:123818805-123818827 TTCTTACAGAAAAACACATGAGG - Intronic
1015186619 6:130424317-130424339 TAGTTTCAGAAAAATGCAGGAGG - Intronic
1016021119 6:139236910-139236932 TTCTTTTAGAATAATAAAGGTGG - Intergenic
1016404185 6:143713305-143713327 TTGTTTCAAAATAATCCTGGAGG + Intronic
1016494507 6:144644987-144645009 TTGTTTCAAAACAGTTCATGTGG + Intronic
1016695747 6:146992819-146992841 GTGTTTCAGAATTTTACATTTGG + Intergenic
1017218503 6:151938092-151938114 TTGTTTCTCAATAATTCATGGGG - Intronic
1017652694 6:156597702-156597724 CTGTTTCATAATAATACATGAGG - Intergenic
1018188640 6:161289360-161289382 TTTTTCCAGAAAAATAGATGTGG - Intergenic
1019363273 7:616825-616847 TTTTTTCCCAAAAATACATGAGG - Intronic
1020617822 7:10481735-10481757 TTGTTTCAAAATAATACAATAGG - Intergenic
1020839536 7:13198166-13198188 TTGTTTCAGAATAGCTTATGTGG + Intergenic
1021060448 7:16104560-16104582 TTGTGTCAGAAGAGTTCATGTGG + Intronic
1021061373 7:16117061-16117083 CTATATCAGAAAAATACATGTGG - Intronic
1021711532 7:23420925-23420947 TTGTTTCAAAATAACTCATGTGG + Intronic
1021901766 7:25292484-25292506 TTGTTACCAAATAATAGATGAGG + Intergenic
1022659191 7:32350269-32350291 TTGCTTCAAAATGATACAGGAGG - Intergenic
1023900492 7:44474027-44474049 TTGTTTCAAAATAAACCAGGAGG + Intronic
1023927304 7:44678905-44678927 CTGTTTCACAATCATGCATGAGG - Intronic
1024289259 7:47789100-47789122 TTGTTTCATAAAAACACATTCGG + Intronic
1025761651 7:64401447-64401469 ATGTGACAGACTAATACATGTGG - Intergenic
1027208508 7:76123960-76123982 TTGCTACAGAAGAATACCTGAGG - Intergenic
1027595395 7:80167493-80167515 TTGTTTCGGAATATTATAGGGGG - Intronic
1027840421 7:83303989-83304011 TGCTTTCAGAATAATCCATGGGG - Intergenic
1027950568 7:84809649-84809671 TTGTATCAGGATATTAAATGAGG + Intergenic
1028128399 7:87142036-87142058 TTGTTGCAACATAATAAATGTGG + Intergenic
1028247825 7:88503130-88503152 TTGTATCAAAATATCACATGTGG - Intergenic
1028474736 7:91240786-91240808 TTGTTTCCGTTTAATACACGAGG - Intergenic
1028718443 7:94001584-94001606 TTCTTTTATAATAAAACATGTGG - Intronic
1028761879 7:94506511-94506533 TTGTTTTAGAGTAATACATAGGG + Intergenic
1028827640 7:95291719-95291741 AAGTTTCAGAATAAGACTTGAGG + Intronic
1029885085 7:103860709-103860731 TTGTTTTAGAATTATAATTGGGG - Intronic
1030079351 7:105763803-105763825 TTCCTTCATAATTATACATGGGG + Intronic
1030080629 7:105774755-105774777 TTGTTTAAGAAGATTACATATGG + Intronic
1030318975 7:108144814-108144836 TAATTTCAGAATAATAAATGAGG - Intergenic
1030720441 7:112864528-112864550 TTGTTTAAGAATCATTCTTGAGG - Intronic
1030899997 7:115111505-115111527 TTTCTTAAAAATAATACATGTGG - Intergenic
1031137070 7:117896272-117896294 TTTTTTCAAAATAATACAGTTGG - Intergenic
1033245978 7:139716556-139716578 ATGATTCAGAATAATGCAAGCGG - Exonic
1034041921 7:147886712-147886734 ATGTTTCCGAATCATACCTGAGG + Intronic
1034534066 7:151715984-151716006 TTGCTTCAAAATAATCCAAGGGG + Intronic
1034761610 7:153677736-153677758 TTGCTGCAGAATTATCCATGGGG - Intergenic
1035442586 7:158914815-158914837 TTGTTTCAAAATAACTGATGGGG - Intronic
1038526062 8:28274468-28274490 TTATTCCAGGATGATACATGTGG + Intergenic
1039200771 8:35091270-35091292 TGTTTTCAGAACAATACATATGG + Intergenic
1041833834 8:62188307-62188329 TTGCTTCAAAATAATGCAGGGGG + Intergenic
1042064201 8:64856027-64856049 TTGTTTCAAAATAACACAGGAGG - Intergenic
1042655643 8:71092317-71092339 TTGTTTTAGAAGAGTCCATGTGG - Intergenic
1043948972 8:86286721-86286743 TTGCTACAGAAAAATACCTGAGG + Intronic
1044812651 8:96079782-96079804 TTTCTTCAAAATAATACAGGTGG + Intergenic
1045193433 8:99906002-99906024 TTGCTTCAAAATAATACAAGTGG + Intergenic
1045955683 8:107903469-107903491 TTACTTCAGAATAATATATTGGG - Intronic
1046392092 8:113588081-113588103 TTCTTCTAGAATAATTCATGAGG - Intergenic
1047057052 8:121176926-121176948 TTTCTATAGAATAATACATGAGG - Intergenic
1050058587 9:1680932-1680954 CTGTCTAAGAACAATACATGTGG + Intergenic
1051388744 9:16540269-16540291 TTGTTTCAGGAGAATACTAGGGG + Intronic
1054722674 9:68618716-68618738 TTGTCCAAGAAGAATACATGTGG - Intergenic
1054822510 9:69537590-69537612 TTCTTTCAAAATAAGTCATGAGG + Intronic
1055134424 9:72811409-72811431 GTGTTTCAGAAGAGTTCATGAGG + Intronic
1055876631 9:80950994-80951016 TTGTTTCAGAATTTTGCATAAGG + Intergenic
1057774496 9:97995618-97995640 TGGGTTAAGTATAATACATGAGG + Intronic
1058073789 9:100629788-100629810 TTGCTTCAGAATATTACATTTGG + Intergenic
1058334331 9:103806610-103806632 TGATTTCAGAATAATACAAGTGG + Intergenic
1058636621 9:107044438-107044460 TAATTCCAGAATAATCCATGTGG + Intergenic
1058803911 9:108571449-108571471 TTGTTTTTGTATCATACATGGGG - Intergenic
1058928107 9:109688909-109688931 TTATTGCAGAAAAATACATTTGG - Intronic
1059549879 9:115218210-115218232 TTTTTTCTGAATAATATTTGTGG - Intronic
1059639152 9:116199691-116199713 TTGCTTCAGAGGAATACCTGAGG + Intronic
1059745600 9:117197512-117197534 TTGCTGCAGAATGATATATGTGG + Intronic
1059938756 9:119337397-119337419 TTGTTTCAGGATAAGCCAGGAGG + Intronic
1061739279 9:132688240-132688262 GTGTTTCAAAATAATCCATCAGG - Intronic
1203369557 Un_KI270442v1:290032-290054 GTATTTCAGAATATCACATGGGG - Intergenic
1186003960 X:5046930-5046952 TTGTTTTGGAATAATACATTTGG + Intergenic
1186018933 X:5232144-5232166 TTGTTTAATAATAATGCATGTGG + Intergenic
1186903186 X:14080664-14080686 ATGTTTCAGAAGAATAATTGGGG + Intergenic
1187284938 X:17896227-17896249 TTGTGTAAGAATAATCTATGGGG + Intergenic
1188188164 X:27142684-27142706 TTGTTTTAGATTATTAAATGTGG - Intergenic
1189461373 X:41245810-41245832 TTGCTTCAGAACAACAAATGTGG + Intergenic
1189844215 X:45117393-45117415 TTGTGGTAGAATAATACATTTGG + Intergenic
1191033341 X:55998368-55998390 ATATTTCAGACTATTACATGGGG + Intergenic
1191060053 X:56285754-56285776 TTGTTTTATAATATTACCTGGGG + Intronic
1192581438 X:72285975-72285997 TAGTTGCAGAATAATACATATGG - Intronic
1193434510 X:81455679-81455701 TTGTTACATAGGAATACATGTGG - Intergenic
1193961693 X:87933751-87933773 ATGTTTTAGAAAAATAAATGTGG - Intergenic
1194106396 X:89772825-89772847 TAGTTTCTGAAAAAGACATGTGG - Intergenic
1195894921 X:109735842-109735864 TTGTTACAGAATAATAAAATAGG - Intergenic
1196364139 X:114904366-114904388 TTATTTCAAAATAATACGGGAGG - Intronic
1196799237 X:119527638-119527660 TTTTTTAAGAAAAATATATGAGG - Intergenic
1197523496 X:127529483-127529505 TTGTTTTAGAAGAATAAATCTGG + Intergenic
1197554915 X:127941222-127941244 TTGTTTCACCATAATACACATGG + Intergenic
1199179514 X:144836797-144836819 TTGTTTCAAAATAACACAGATGG + Intergenic
1199577875 X:149332125-149332147 TTGCTTCAAAATAATATAGGAGG + Intergenic
1200891842 Y:8332318-8332340 TTATTTCATAATAATCCATGTGG - Intergenic
1201209283 Y:11664614-11664636 TTGTTTCAGACCAATGCATTCGG - Intergenic