ID: 1092956321

View in Genome Browser
Species Human (GRCh38)
Location 12:13553585-13553607
Sequence GGTCCTGTTGGACCACCACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 81}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092956317_1092956321 13 Left 1092956317 12:13553549-13553571 CCACAAATGTGGAAGTAGCGTGT 0: 1
1: 0
2: 0
3: 8
4: 77
Right 1092956321 12:13553585-13553607 GGTCCTGTTGGACCACCACCTGG 0: 1
1: 0
2: 1
3: 10
4: 81
1092956315_1092956321 20 Left 1092956315 12:13553542-13553564 CCCAAGGCCACAAATGTGGAAGT 0: 1
1: 0
2: 2
3: 26
4: 262
Right 1092956321 12:13553585-13553607 GGTCCTGTTGGACCACCACCTGG 0: 1
1: 0
2: 1
3: 10
4: 81
1092956316_1092956321 19 Left 1092956316 12:13553543-13553565 CCAAGGCCACAAATGTGGAAGTA 0: 1
1: 0
2: 0
3: 25
4: 191
Right 1092956321 12:13553585-13553607 GGTCCTGTTGGACCACCACCTGG 0: 1
1: 0
2: 1
3: 10
4: 81
1092956313_1092956321 22 Left 1092956313 12:13553540-13553562 CCCCCAAGGCCACAAATGTGGAA 0: 1
1: 0
2: 1
3: 27
4: 232
Right 1092956321 12:13553585-13553607 GGTCCTGTTGGACCACCACCTGG 0: 1
1: 0
2: 1
3: 10
4: 81
1092956314_1092956321 21 Left 1092956314 12:13553541-13553563 CCCCAAGGCCACAAATGTGGAAG 0: 1
1: 0
2: 3
3: 50
4: 394
Right 1092956321 12:13553585-13553607 GGTCCTGTTGGACCACCACCTGG 0: 1
1: 0
2: 1
3: 10
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092956321 Original CRISPR GGTCCTGTTGGACCACCACC TGG Exonic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
911534959 1:99089236-99089258 GGTTCTGTTGGACCAGCCCCAGG + Intergenic
919860179 1:201734747-201734769 GGGCCTGATGGACCCTCACCTGG - Intronic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
1063516925 10:6705913-6705935 AGTCCTGTTGGAACACCTCTGGG - Intergenic
1064556195 10:16549593-16549615 GGTCCTGATGGAACTCCACTGGG - Intergenic
1066478609 10:35773193-35773215 GTTCCTGTTGCTCCACAACCTGG + Intergenic
1069839726 10:71332018-71332040 GGTTCTGCAGGAACACCACCTGG - Intronic
1072570915 10:96656812-96656834 GGTCCGGCTGCACCACCATCAGG + Exonic
1074782879 10:116814707-116814729 GGACCTGCTGAATCACCACCAGG + Intergenic
1074969618 10:118525340-118525362 GAACCTGTTGAACCAACACCAGG - Intergenic
1075633588 10:124015927-124015949 GGTCCGGTTGGAGAGCCACCAGG - Intronic
1075684227 10:124353020-124353042 GGTCCTGTTGGCCCAACGCCTGG + Intergenic
1076662923 10:132067462-132067484 CTTGCTGTGGGACCACCACCTGG - Intergenic
1077089259 11:771060-771082 CGTCGTGCTGGACCGCCACCTGG - Exonic
1077161525 11:1114882-1114904 GGGGCTGCTGTACCACCACCAGG + Intergenic
1077443505 11:2579471-2579493 GTCCCTGATGGCCCACCACCTGG - Intronic
1083111916 11:60418828-60418850 GTTCCTGAATGACCACCACCTGG + Intergenic
1090188711 11:124754248-124754270 GGTCCTCTTGTACCACCGCCGGG - Exonic
1092956321 12:13553585-13553607 GGTCCTGTTGGACCACCACCTGG + Exonic
1095942602 12:47736777-47736799 AGTCCTATTGGACCACCACGGGG + Intronic
1099762093 12:86936935-86936957 GTTCCTGTTGCTCCACAACCTGG - Intergenic
1101605844 12:106247440-106247462 GGACCTGCTGGACCTCCTCCAGG + Exonic
1102349862 12:112184378-112184400 GGGCCTGTTGGAGCCCCACGCGG - Exonic
1103359711 12:120346431-120346453 AGTCCTGTGGGCCCACCTCCTGG + Intronic
1105846335 13:24297455-24297477 CTTCCTGTTTGACCACCAGCTGG + Exonic
1106486719 13:30179204-30179226 TGGCCTGTTGGACCAAAACCTGG + Intergenic
1108314056 13:49220862-49220884 GGTCCTGCTCGACGCCCACCAGG - Exonic
1108527510 13:51298606-51298628 GGTCCTGTCTGCCCACCACTTGG + Intergenic
1114871023 14:26658832-26658854 GTTCATGGTGGCCCACCACCTGG - Intergenic
1121216464 14:92252219-92252241 GGCCCAGCAGGACCACCACCCGG - Intergenic
1121413116 14:93761505-93761527 GGTCCTGTGGTACAACCATCAGG - Intronic
1128073598 15:64812477-64812499 GGTCCTCTGGGAGCACCACAGGG + Intergenic
1130578610 15:85115353-85115375 TGTCCTGTGGGAGGACCACCTGG + Intronic
1137002822 16:35246162-35246184 GGACCTGCTGCACCAACACCTGG + Intergenic
1137016723 16:35384382-35384404 GGACCTGCTGAACCAACACCTGG + Intergenic
1140501943 16:75440664-75440686 GGTCCAGTTGGTCCACCACCAGG + Intronic
1143341718 17:6216280-6216302 GGTTCTGGTGGCCCACCACATGG - Intergenic
1146525304 17:33562540-33562562 TGTCCTGGAGGGCCACCACCAGG + Intronic
1149317377 17:55451225-55451247 GGTCCTGTTATGCCACCATCTGG - Intergenic
1150069616 17:62139909-62139931 GGCCGTGGTGGACCACCAGCAGG + Intergenic
1151802692 17:76387106-76387128 GGCCCTGCTGGACCACAACGGGG - Exonic
1152450246 17:80374119-80374141 GGCACTGTTTGACTACCACCTGG + Intronic
1153945561 18:10014229-10014251 GCTCATGTTGGCCCACCTCCTGG + Intergenic
1155218763 18:23665885-23665907 AATCCTGTTGGACCATCAACTGG - Intergenic
1160895868 19:1401548-1401570 GGGCCTGTTGGACCCGCCCCCGG - Exonic
1161459613 19:4389046-4389068 GCTGCTGTTGAGCCACCACCAGG + Intronic
1163614531 19:18318826-18318848 GACCCTCTTGGGCCACCACCTGG + Intronic
1163739181 19:19000141-19000163 GGTCCTGTGTGACCACCCCCCGG + Intronic
932711611 2:74069510-74069532 GAACCTGTGTGACCACCACCTGG + Intronic
936147009 2:109986879-109986901 GGCGCTGCTGGAGCACCACCTGG - Intergenic
936197683 2:110384604-110384626 GGCGCTGCTGGAGCACCACCTGG + Intergenic
943536091 2:189152592-189152614 GCTCCTGTTGCTCCACCCCCTGG + Intronic
943928548 2:193819925-193819947 GGTGCTGTTGCAACACAACCAGG - Intergenic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
946875912 2:224129776-224129798 GGTCCTTTCTCACCACCACCTGG + Intergenic
947727645 2:232409935-232409957 CGTCCTGCCGGACCTCCACCTGG + Exonic
1169426650 20:5502253-5502275 GGTCCTGGTGGAGCACTTCCAGG - Intergenic
1172505887 20:35462338-35462360 GGACCTGTGGGCCTACCACCTGG + Exonic
1172605259 20:36209595-36209617 GTTCCTGAAGGACAACCACCTGG + Exonic
1175612769 20:60365245-60365267 GGTCCTGTAGCACCCCCATCAGG + Intergenic
1181171266 22:21011564-21011586 GGACCTGTTGGAGAACCAGCTGG - Intronic
1182787720 22:32921498-32921520 GGTCCTGTTGAGCCCACACCAGG - Intronic
1183585621 22:38751370-38751392 GGTCCTGTGGGACAACCATGAGG + Exonic
1183623765 22:38989571-38989593 GGTCCTGATGGACCAGCACATGG + Exonic
950116007 3:10450683-10450705 GGTCCCTATGGACCAGCACCAGG + Intronic
950787786 3:15450328-15450350 GGGCCTGGTGGACCATCACCTGG - Exonic
953545393 3:43860583-43860605 GGTCCTGAGGCCCCACCACCAGG - Intergenic
954238574 3:49275927-49275949 GATCTTTTTGGACCATCACCAGG - Intronic
955744251 3:62124548-62124570 CAGCCTGTTGGACCACCGCCTGG - Intronic
956459420 3:69455890-69455912 GATCCTGTTCCACCATCACCTGG + Intronic
958084134 3:88784389-88784411 GTTCCTGTTGCTCCACAACCTGG - Intergenic
961086588 3:124072907-124072929 GGTCCTGTTGGAGAACCAAAGGG - Intergenic
962205229 3:133428707-133428729 GGGCCTGTTGGAGAGCCACCTGG + Intronic
967891186 3:194365692-194365714 GGACCTGCTGGACCTCCAGCAGG + Intronic
970364141 4:15341707-15341729 GGTCCTCTCGGACCATCCCCAGG + Intronic
971396159 4:26229420-26229442 GGTGCTGTGGGGCCACCAACAGG - Intronic
973686095 4:53371321-53371343 GGTTCTTGTGGACCACTACCAGG - Intergenic
984512978 4:180701558-180701580 GCTCCTGTTGGGCCACCAGCTGG - Intergenic
999319674 5:150605679-150605701 GGTCTGGCTGGACCACCTCCTGG + Intronic
1001256185 5:170185133-170185155 GGGGCTCTTGGAGCACCACCTGG + Intergenic
1006401758 6:33821791-33821813 GGTCCTGTAGGACCACTAACTGG + Intergenic
1019526025 7:1480898-1480920 GCTCATGCTGGACCTCCACCAGG + Exonic
1023045651 7:36208114-36208136 GGTCCTGTTGGCCCAGGCCCAGG - Intronic
1029605291 7:101595341-101595363 GCTCATTTTGCACCACCACCTGG - Intergenic
1033599491 7:142878391-142878413 GGTCCTGTTTGACCCTCACCAGG + Intronic
1034267274 7:149787288-149787310 GGGTCTGTTTTACCACCACCAGG - Intergenic
1045244376 8:100430075-100430097 GGTTCTGTTGTCCCACCATCAGG - Intergenic
1046747202 8:117888992-117889014 GCTCCTGGTGAACCACCATCAGG - Intronic
1048329966 8:133464683-133464705 GGTCCTGCTGTGCCTCCACCGGG - Intronic
1057776853 9:98018367-98018389 GCTCCTGTATCACCACCACCAGG + Intergenic
1197808261 X:130417537-130417559 TGTATTCTTGGACCACCACCAGG + Intergenic
1200742424 Y:6868387-6868409 GGTGCTGTTGGGACACCACGGGG + Exonic