ID: 1092957224

View in Genome Browser
Species Human (GRCh38)
Location 12:13561940-13561962
Sequence CCAAACAATCACACTGCTTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 214}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092957219_1092957224 20 Left 1092957219 12:13561897-13561919 CCAAAATTCAGGTAATACATGGC 0: 1
1: 0
2: 0
3: 9
4: 143
Right 1092957224 12:13561940-13561962 CCAAACAATCACACTGCTTGGGG 0: 1
1: 0
2: 0
3: 21
4: 214
1092957220_1092957224 -2 Left 1092957220 12:13561919-13561941 CCATCTCTGTCTGTATATAAGCC 0: 1
1: 0
2: 3
3: 20
4: 187
Right 1092957224 12:13561940-13561962 CCAAACAATCACACTGCTTGGGG 0: 1
1: 0
2: 0
3: 21
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092957224 Original CRISPR CCAAACAATCACACTGCTTG GGG Exonic
902032784 1:13434830-13434852 ACAACCAATCAGACTGATTGTGG + Intergenic
906298679 1:44665099-44665121 CCAAACCATCAGACTGAGTGAGG + Intronic
907280580 1:53344452-53344474 CCACACAAGCTCACTGCTTGTGG + Intergenic
909498177 1:76303179-76303201 GCAACCAATCAGACTGATTGTGG - Intronic
909741904 1:79039241-79039263 GCAACCAATCAGACTGATTGTGG - Intergenic
910587167 1:88892623-88892645 ACAACCAATCAGACTGATTGTGG - Intergenic
910635829 1:89406317-89406339 CCAAACAATAAAACTACTGGAGG - Intergenic
912882428 1:113429530-113429552 ACAAGCAATCAGACTGATTGTGG - Intronic
914265756 1:146037331-146037353 CCAAACAATAACTCTCCTAGGGG + Intergenic
915744854 1:158148046-158148068 ACAACCAATCAGACTGATTGTGG + Intergenic
916918001 1:169430882-169430904 ACAACCAATCAGACTGATTGCGG - Intronic
920132107 1:203740305-203740327 AAAAACAATCACACTACTGGCGG - Exonic
922779293 1:228239189-228239211 ACTCACAATCACACTGCATGTGG - Intronic
922873407 1:228921082-228921104 CCAAACAATCCCACAGCATCAGG - Intergenic
923111727 1:230896174-230896196 CCAAACCATATCACTGCGTGTGG + Intergenic
923172783 1:231432222-231432244 GCAACCAATCAGACTGATTGCGG - Intergenic
923250524 1:232176177-232176199 GCTCACAATGACACTGCTTGGGG + Intergenic
923633227 1:235669455-235669477 GCAACCAATCAAACTGATTGTGG + Intronic
924251047 1:242133273-242133295 GCAACCAATCAGACTGGTTGTGG + Intronic
924562775 1:245170878-245170900 CCAAACATGAACACTGCCTGAGG - Intronic
924902798 1:248419406-248419428 CAAAACAATCACTCTGCATAAGG - Intergenic
1063165795 10:3460875-3460897 CCAAACAATGAAATTGCTTATGG + Intergenic
1064799660 10:19054632-19054654 CCACACAATCTCACTACATGTGG - Intronic
1065781635 10:29174439-29174461 ACAACCAATCAGACTGGTTGTGG - Intergenic
1068026317 10:51649838-51649860 GCAACCAATCAGACTGATTGCGG - Intronic
1069503048 10:68971476-68971498 CCAGACAGGCAGACTGCTTGAGG - Intronic
1071014891 10:80985099-80985121 ACAAAAAATCATACTGCTTTTGG - Intergenic
1071870150 10:89785217-89785239 TCAATCAATCAGACTGATTGTGG - Intergenic
1075806909 10:125195702-125195724 CCGAACAACCACACTGCAGGTGG + Intergenic
1078686424 11:13536571-13536593 CCAAACGATATCACTGCTTTTGG - Intergenic
1082960790 11:58916968-58916990 ACAACCAATCAAACTGCTTGTGG - Intronic
1084198427 11:67539679-67539701 ACAAACAATCAGACTGATTGTGG + Intergenic
1086902561 11:92384158-92384180 CCAAAAAAAATCACTGCTTGAGG - Intronic
1089385610 11:118065625-118065647 ACAACCAATCAGACTGATTGTGG + Intergenic
1092015539 12:5155619-5155641 GCAAACAATCGCTCTGCATGTGG + Intergenic
1092957224 12:13561940-13561962 CCAAACAATCACACTGCTTGGGG + Exonic
1095487009 12:42695705-42695727 GCAACCAATCAGACTGATTGTGG + Intergenic
1097596363 12:61637210-61637232 GCAAACAATCAGACTGACTGTGG + Intergenic
1098543337 12:71684208-71684230 ACAACCAATCAGACTGATTGTGG - Intronic
1099227807 12:79990838-79990860 GCAACCAATCAGACTGATTGCGG + Intergenic
1099633400 12:85179359-85179381 ACAAACCATAACACTGCTTATGG - Intronic
1100077477 12:90803076-90803098 GCAACCAATCAGACTGATTGAGG - Intergenic
1100572591 12:95857381-95857403 GCAACCAATCAGACTGGTTGTGG + Intergenic
1100661033 12:96699029-96699051 GCAACCAATCAGACTGATTGTGG - Intronic
1101093568 12:101313019-101313041 CCCAACAGCAACACTGCTTGGGG + Intronic
1101168498 12:102063365-102063387 TCAACCAATCAGACTGATTGCGG - Intergenic
1101655469 12:106716339-106716361 CCCAATAGTGACACTGCTTGGGG + Intronic
1103325172 12:120115735-120115757 CCACACACACACACTGCTTGAGG - Intronic
1106382350 13:29252563-29252585 CCAAACCATATCACTGCTTTAGG - Intronic
1108311029 13:49190950-49190972 CCAAATAATCAGATTGCTTTTGG - Intronic
1108804738 13:54140563-54140585 CATAACAAACACACTCCTTGTGG + Intergenic
1109631197 13:65048970-65048992 ACAACCAATCAGACTGATTGTGG - Intergenic
1111742367 13:92219777-92219799 GCAACCAATCAGACTGATTGTGG + Intronic
1112448294 13:99487131-99487153 ACAACCAATCAGACTGATTGTGG - Intergenic
1112449557 13:99496458-99496480 GCAACCAATCAGACTGATTGTGG - Intergenic
1112449594 13:99496792-99496814 CCAACCAATCAGACTGATTGTGG - Intergenic
1112995730 13:105573274-105573296 CCACATAATCACTCTGATTGTGG + Intergenic
1117467226 14:56005688-56005710 CCCAACAAACCCCCTGCTTGGGG - Intergenic
1118807161 14:69248090-69248112 ACAAAAAATCACAGTCCTTGTGG - Intergenic
1125052779 15:35320745-35320767 CCAAAAACTCACACTGCTGATGG + Intronic
1127775489 15:62261229-62261251 GCAACCAATCAGACTGATTGCGG + Intergenic
1129386452 15:75198796-75198818 TCAACCAATCAGACTGGTTGCGG - Intronic
1130235142 15:82126534-82126556 CCAAACAATCCCAGCCCTTGAGG + Intergenic
1131071534 15:89469546-89469568 GCAACCAATCAGACTGGTTGCGG + Intergenic
1131151856 15:90052186-90052208 CCAGACACTCACACAGCTCGAGG + Intronic
1131294132 15:91132280-91132302 GCAACCAATCAGACTGATTGTGG - Intronic
1134383649 16:13751459-13751481 CCACACAACCACACTGGTTGGGG + Intergenic
1135123354 16:19785579-19785601 ACAACCAATCAGACTGATTGCGG + Intronic
1135132651 16:19865459-19865481 CAAAACAATGACACTATTTGAGG - Intronic
1135673145 16:24391855-24391877 CCCTACAATCTCACAGCTTGAGG + Intergenic
1138896543 16:61212359-61212381 CTGAACAATCACTGTGCTTGTGG - Intergenic
1145220185 17:21082166-21082188 CCAGACAATCAGACTGGTCGTGG + Intergenic
1145277360 17:21440589-21440611 CCAGAAAATCAAACTGCTTGGGG - Intergenic
1145315196 17:21726484-21726506 CCAGAAAATCAAACTGCTTGGGG - Intergenic
1145713627 17:26998420-26998442 CCAGAAAATCAAACTGCTTGGGG - Intergenic
1147220393 17:38925471-38925493 CCAACCAATCACAAAGCCTGGGG - Intergenic
1149115872 17:53096012-53096034 CCAAAAAATTATATTGCTTGAGG + Intergenic
1151116499 17:71741136-71741158 CCAAAAAATCACATGGGTTGGGG + Intergenic
1151159098 17:72150087-72150109 CCATACAACCACCCTGCTGGTGG - Intergenic
1151715985 17:75831305-75831327 CCACACACTCACAGTGCTGGTGG - Exonic
1151971009 17:77457402-77457424 CCCATCACTCTCACTGCTTGAGG + Intronic
1154419850 18:14218528-14218550 CAAAACAAACACACTGCTATAGG - Intergenic
1155338190 18:24786281-24786303 CCAAACAATAACATTCATTGTGG - Intergenic
1156474809 18:37398672-37398694 CCAGCCACTGACACTGCTTGAGG + Intronic
1157335888 18:46737041-46737063 CCACCCACTCACACTGCATGAGG + Intronic
1164187783 19:22886442-22886464 CCAAGCAGTCACACTGTTGGAGG + Intergenic
1165054578 19:33166256-33166278 CCAAACAGTGAGACTGGTTGTGG + Intronic
1165533576 19:36424078-36424100 GCAACCAATCAGACTGGTTGTGG - Intergenic
925372503 2:3357062-3357084 ACAACCAATCACACTGATTGTGG + Intronic
926384610 2:12323820-12323842 CCAAATAATCACAAACCTTGTGG + Intergenic
926458968 2:13103729-13103751 CCCAACAACCAAACTGCTTCCGG + Intergenic
926812055 2:16763987-16764009 GCAATCAATCAGACTGATTGTGG - Intergenic
929711497 2:44271329-44271351 GCAATCAATCAGACTGATTGTGG - Intergenic
929711511 2:44271490-44271512 ACAACCAATCAGACTGATTGCGG - Intergenic
929711521 2:44271575-44271597 GCAACCAATCAGACTGATTGCGG - Intergenic
930552566 2:52853386-52853408 ACAAACAATCACTGAGCTTGAGG - Intergenic
930653060 2:53981438-53981460 ACAACCAATCAGACTGATTGTGG - Intronic
931108256 2:59081665-59081687 CCACACAATCACAATGCGAGAGG - Intergenic
934660400 2:96140384-96140406 AGAAATAATCACCCTGCTTGGGG + Intergenic
936249222 2:110854508-110854530 GCAAACAAACACCCTCCTTGGGG - Intronic
936748470 2:115610476-115610498 ACACACACTCATACTGCTTGTGG - Intronic
940396585 2:153197633-153197655 CCACTCAAACACACTGCCTGGGG - Intergenic
943099429 2:183470831-183470853 CAAAACAATCACAGTGATGGTGG - Intergenic
945081693 2:206092302-206092324 CCAATCATTCATACTGCTTTGGG - Intergenic
948075462 2:235162273-235162295 GCAACCAATCAGACTGGTTGTGG - Intergenic
948289069 2:236811181-236811203 ACAACCAATCAGACTGATTGCGG + Intergenic
948355534 2:237374367-237374389 CCAGACAATGACACTGAGTGAGG + Intronic
1169685627 20:8267901-8267923 ACAACCAATCAGACTGGTTGTGG - Intronic
1170485758 20:16814617-16814639 GCAAACAACCACACAGCTAGTGG - Intergenic
1171494195 20:25543639-25543661 GCAACCAATCAGACTGATTGTGG + Intronic
1175242310 20:57558765-57558787 CCAAACAGCCACCCTGCTGGTGG - Intergenic
1176853446 21:13940783-13940805 CAAAACAAACACACTGCTATAGG + Intergenic
1178177935 21:30126434-30126456 CCAGAGAATCACATTGCTTCAGG - Intergenic
1179453874 21:41485029-41485051 CCAGCCAATCACATTTCTTGGGG - Intronic
1179497149 21:41779362-41779384 GCAACCAATCAGACTGATTGTGG + Intergenic
1179622969 21:42630968-42630990 CCACACATGCAAACTGCTTGGGG + Intergenic
1179938097 21:44617646-44617668 CTATACAATCACAATGCTGGGGG + Intronic
1180932662 22:19603830-19603852 ACAATCAATCAGACTGATTGTGG + Intergenic
1184475934 22:44721351-44721373 GCAACCAATCACACTGATTGCGG - Intronic
1184624403 22:45712321-45712343 CCAAACACTGACAGTCCTTGTGG - Intronic
1184958923 22:47914649-47914671 CCAACCAATCAGACTGATTGTGG - Intergenic
949720063 3:6978500-6978522 CCAAACAATTAAATTGCTTTGGG + Intronic
951678391 3:25268089-25268111 CCAAACAAAAAAAGTGCTTGAGG + Intronic
953319117 3:41956122-41956144 ACAACCAATCAGACTGATTGGGG + Intronic
955290966 3:57692438-57692460 CCAAACAAACATCCTGCCTGCGG + Intronic
955509076 3:59661430-59661452 ACAAACAAGCACAGTGCTGGCGG - Intergenic
955579526 3:60404040-60404062 ACAACCAATCAGACTGATTGTGG + Intronic
955904762 3:63795058-63795080 ACAACCAATCAGACTGATTGCGG + Intergenic
955904777 3:63795221-63795243 GCAACCAATCAGACTGATTGAGG + Intergenic
957568722 3:81918326-81918348 CCAACCAATCACATTCCTGGGGG + Intergenic
957981453 3:87516501-87516523 ACAAACAGTAACACTGCTTGGGG + Intergenic
958434828 3:94083469-94083491 CCAACCAATCAGACTGATTGCGG - Intronic
958673022 3:97228833-97228855 GCAAACACTTACACTGCTGGTGG - Intronic
961791534 3:129380041-129380063 GCAACCAATCACAATGGTTGTGG + Intergenic
962349323 3:134645040-134645062 CCAGCCAATCACCCTCCTTGAGG - Intronic
963159234 3:142133505-142133527 CCAAACAAACAAACTGCTTTTGG - Intronic
963770984 3:149385889-149385911 GCAAGCAATCAGACTGATTGCGG - Intergenic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
966638105 3:182158018-182158040 CCAAGAAGCCACACTGCTTGGGG + Intergenic
969085294 4:4652025-4652047 GCAGTCAATCACACTGATTGCGG + Intergenic
969655573 4:8495861-8495883 ACAAACAATCAGACTGGTTGTGG + Intergenic
969935371 4:10674708-10674730 CCAAACAACCCCACAGCTTTGGG + Intronic
971541503 4:27822791-27822813 GCAAACAATCACACTGCCCATGG + Intergenic
974544709 4:63286244-63286266 TCAAACAATTACACTACATGAGG - Intergenic
978802162 4:112765503-112765525 ACAAACAAACAGAATGCTTGAGG - Intergenic
979424162 4:120544848-120544870 GCAACCAATCAGACTGATTGTGG - Intergenic
980407400 4:132371064-132371086 GCAACCAATCAGACTGATTGCGG + Intergenic
980837586 4:138216036-138216058 CCAAACATTCACACATCCTGTGG + Intronic
980846155 4:138327742-138327764 CAAAACAAATACAGTGCTTGAGG + Intergenic
981346392 4:143682406-143682428 GCAACCAATCAGACTGATTGCGG + Intronic
985951482 5:3224924-3224946 CCAAACATTCAGAGTGCTGGGGG - Intergenic
986702558 5:10425262-10425284 CCAATCCATCACACTCCTGGTGG - Intronic
986808971 5:11335825-11335847 ACAACCAATCAGACTGATTGTGG + Intronic
988297356 5:29382834-29382856 ACAACCAATCAGACTGATTGTGG + Intergenic
991154884 5:63421443-63421465 CCAAAAAATTATAGTGCTTGAGG - Intergenic
991343508 5:65638285-65638307 CCAAGCAATCACAAATCTTGTGG - Intronic
991913785 5:71586764-71586786 ACAACCAATCAGACTGATTGGGG - Intergenic
992435949 5:76756284-76756306 GCAACCAATCAGACTGATTGTGG - Intergenic
992547901 5:77833092-77833114 CCAGACAATTACACTGCCCGGGG - Intronic
993481803 5:88432981-88433003 CCCAATAAGCACAATGCTTGAGG - Intergenic
995598425 5:113771800-113771822 GCAACCAATCAGACTGATTGTGG - Intergenic
995599193 5:113777238-113777260 GCAAACAATCAGACTGATTGCGG - Intergenic
996243607 5:121232609-121232631 ACAACCAATCAGACTGCTCGTGG - Intergenic
997572803 5:134945188-134945210 CAAAAAAAGCACACTGCTGGAGG - Intronic
999362557 5:150998206-150998228 GCAAACAATCAGACTGATTGGGG - Intergenic
999856213 5:155597085-155597107 GCAAATAATCACACTGTTTCAGG - Intergenic
1003351135 6:5318789-5318811 GCAACCAATCAGACTGGTTGCGG - Intronic
1004706226 6:18126252-18126274 GCAACCAATCAGACTGATTGCGG - Intergenic
1004748940 6:18540982-18541004 CGAAACATTCACACTCTTTGTGG - Intergenic
1008630723 6:53360793-53360815 ACAACCAATCAGACTGATTGCGG - Intergenic
1009542827 6:64985367-64985389 ACAAATAATGACACTGCCTGAGG - Intronic
1011067372 6:83341947-83341969 CCAACCAATCACACTGACTGTGG + Intronic
1014814843 6:125924228-125924250 CCAAAATATCACACTTGTTGAGG + Intronic
1015412271 6:132907585-132907607 GCACACAATCACATAGCTTGAGG - Intergenic
1015547785 6:134379152-134379174 GCAACCAATCAGACTGGTTGTGG - Intergenic
1016769573 6:147834358-147834380 CAAAACAATAACACTGCTTTTGG - Intergenic
1019812739 7:3176507-3176529 CCAAACCAGGGCACTGCTTGAGG - Intergenic
1023480367 7:40627388-40627410 ACAACCAATCAGACTGATTGTGG - Intronic
1023480380 7:40627551-40627573 GCAACCAATCAGACTGATTGTGG - Intronic
1023817305 7:43961063-43961085 TCAACCAATCAGACTGATTGTGG - Intergenic
1024766959 7:52670836-52670858 TCAATCAATCACACTGTTTCTGG + Intergenic
1025854484 7:65265459-65265481 CCAAACAGAGACACTGATTGAGG - Intergenic
1027775873 7:82463609-82463631 ACAACCAATCAGACTGGTTGTGG - Intergenic
1029614526 7:101647969-101647991 ACAAACAAACACACAGCCTGGGG - Intergenic
1030296689 7:107935710-107935732 CCAAATATAGACACTGCTTGGGG - Intronic
1030985955 7:116242263-116242285 TAAAACTATCACACTGCTTTTGG - Intronic
1032700973 7:134378758-134378780 GCAACCAATCAGACTGATTGCGG - Intergenic
1032870643 7:135980858-135980880 GCAACCAATCAGACTGATTGCGG - Intergenic
1035936086 8:3841380-3841402 GCAATCAAACACATTGCTTGAGG - Intronic
1037682737 8:21110952-21110974 GCAACCAATCAGACTGATTGGGG + Intergenic
1038385076 8:27136329-27136351 TCAAACAAGCACTCTTCTTGTGG - Intergenic
1039297119 8:36168843-36168865 ACAACCAATCAGACTGATTGTGG + Intergenic
1042999275 8:74737247-74737269 ACAACCAATCAGACTGATTGTGG + Intronic
1043592092 8:81844077-81844099 TCAACCAATCAGACTGGTTGAGG + Intergenic
1044544944 8:93449122-93449144 CCACACAATCACAGAGCTAGAGG + Intergenic
1044553793 8:93540348-93540370 CAAAGCACTCACACTGCTTCTGG - Intergenic
1045473508 8:102534414-102534436 ACAAACAATCACACTGGAAGGGG - Intronic
1048756914 8:137749733-137749755 CCATTAAATCACACTGCTTTCGG + Intergenic
1050137844 9:2486764-2486786 CCAAACAACCAAGATGCTTGAGG + Intergenic
1050567210 9:6898246-6898268 CGAGACAATCATAGTGCTTGAGG - Intronic
1051004853 9:12331088-12331110 ATAATAAATCACACTGCTTGTGG - Intergenic
1056463386 9:86829687-86829709 CCAACCATTTACAATGCTTGGGG + Intergenic
1056888645 9:90468622-90468644 CAAGGTAATCACACTGCTTGGGG - Intergenic
1057926714 9:99158931-99158953 GCAACCAATCAGACTGATTGAGG + Intergenic
1058310556 9:103496443-103496465 GCAACCAATCAGACTGGTTGTGG - Intergenic
1062258687 9:135645552-135645574 CCAAAAAATCACATGGCTGGTGG - Intergenic
1185461336 X:333983-334005 CAAAACATTCACACAGCCTGTGG + Exonic
1185696605 X:2199587-2199609 CCAAAAAATAACTCAGCTTGAGG + Intergenic
1186344895 X:8681948-8681970 TGAAAGAATCACACTGATTGGGG + Intronic
1188282678 X:28289573-28289595 GCAACCAATCAGACTGATTGCGG - Intergenic
1188569003 X:31559746-31559768 CCGAACCCTCACACTGTTTGAGG + Intronic
1188680866 X:33002627-33002649 CCAACCAATCAGACTGATTGCGG - Intronic
1189375094 X:40460288-40460310 CCATGCAATGACACTGCTGGGGG + Intergenic
1189433380 X:40969458-40969480 GCAACCAATCAGACTGATTGTGG - Intergenic
1190766435 X:53479563-53479585 ACAACCAATCAGACTGGTTGTGG - Intergenic
1190957644 X:55211069-55211091 ACAACCAATCATACTGATTGCGG + Intronic
1190957655 X:55211206-55211228 GCAACCAATCAGACTGATTGTGG + Intronic
1192477833 X:71459029-71459051 CCAGCCAATCCCACTGCTAGTGG - Intronic
1192479413 X:71471836-71471858 ACAACCAATCAGACTGATTGTGG - Intronic
1192566579 X:72169168-72169190 GCAACCAATCAGACTGATTGTGG - Intergenic
1194474476 X:94341742-94341764 GCAAAAAATCAGACTGATTGCGG + Intergenic
1194474490 X:94341905-94341927 GCAACCAATCAGACTGATTGTGG + Intergenic
1196759362 X:119187549-119187571 GCAACCAATCAGACTGATTGTGG + Intergenic
1196858503 X:120005894-120005916 GCAACCAATCAAACTGATTGTGG - Intergenic
1197716997 X:129716721-129716743 ACAACCAATCAGACTGATTGCGG - Intergenic
1198341479 X:135718693-135718715 CAAATCAATCAGAATGCTTGTGG - Intronic
1198346519 X:135764670-135764692 CAAATCAATCAGAATGCTTGTGG + Intronic
1198348425 X:135781955-135781977 CAAATCAATCAGAATGCTTGTGG + Intergenic
1198350329 X:135799219-135799241 CAAATCAATCAGAATGCTTGTGG + Intronic
1198352237 X:135816491-135816513 CAAATCAATCAGAATGCTTGTGG + Intronic
1198354145 X:135833759-135833781 CAAATCAATCAGAATGCTTGTGG + Intronic
1198356055 X:135851009-135851031 CAAATCAATCAGAATGCTTGTGG + Intronic
1198357968 X:135868287-135868309 CAAATCAATCAGAATGCTTGTGG + Intergenic
1198359883 X:135885570-135885592 CAAATCAATCAGAATGCTTGTGG + Intronic
1198366728 X:135947359-135947381 CAAATCAATCAGAATGCTTGTGG + Intergenic
1200169259 X:154060590-154060612 CCAAGCAGTAACACAGCTTGTGG + Intronic