ID: 1092960933

View in Genome Browser
Species Human (GRCh38)
Location 12:13596470-13596492
Sequence CCTTCTGAGATGAGGATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 280}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092960933 Original CRISPR CCTTCTGAGATGAGGATGGA GGG Intronic
900515351 1:3079271-3079293 CCCTCTGATGTGAGGCTGGAAGG - Intronic
900800450 1:4733920-4733942 CCTTATGAGATGTGGATCAAAGG + Intronic
905409556 1:37758995-37759017 CATTGAGAGATGAGGATAGATGG - Intronic
906199992 1:43953760-43953782 CCTTGGGAGTTGGGGATGGAGGG + Intronic
906329174 1:44870379-44870401 CTCACTGAGATGAGGAAGGAGGG - Intronic
906694885 1:47817272-47817294 CTTTCTCAAAAGAGGATGGAAGG + Intronic
906922440 1:50078891-50078913 CCTTCTGAGCTCACAATGGAAGG - Intronic
907960592 1:59276649-59276671 TCTTCTGAAATGTGTATGGATGG + Intergenic
910041971 1:82863474-82863496 TCTTCAGGGAGGAGGATGGAAGG - Intergenic
913294308 1:117303936-117303958 CCTGCTGTGAGGAGGAGGGATGG + Intergenic
916757437 1:167786151-167786173 CTTTCTGAGATGAATATAGAGGG + Intronic
917159687 1:172043567-172043589 GCTTCTGAGCTGAGTTTGGAAGG + Intronic
917413066 1:174780275-174780297 CCATCTGAGCAGAGTATGGAGGG - Intronic
918338316 1:183544471-183544493 CCTGCTGGGAAGAGGAGGGAAGG - Exonic
918390671 1:184057227-184057249 TCTTGAGAGATGAGGAAGGATGG + Intronic
919448383 1:197738926-197738948 CTTCCTGAGATGAGGTTGGAAGG + Intronic
920056808 1:203198757-203198779 CCTTATGAGCGGATGATGGAGGG + Intergenic
920327747 1:205179877-205179899 CCTTCTGAGTAGAGGATGGATGG - Intronic
920519325 1:206612108-206612130 CATTTTGAGGTGAGGATGGAGGG - Intronic
921095542 1:211884423-211884445 CCTTCTGCGATCAGGGTGAATGG - Intergenic
921298529 1:213727327-213727349 CCTTCTGAGATGAGGGTACAGGG + Intergenic
924006054 1:239612749-239612771 CCTTCTGAAGTGAGGTGGGATGG + Intronic
1063122745 10:3115937-3115959 GCTGCTGAGATGCGGGTGGATGG - Intronic
1064705299 10:18066817-18066839 CCTTCTTAGGTGAGGCTGGATGG + Intergenic
1066470395 10:35692185-35692207 ATTTCTGAGAAGCGGATGGAAGG - Intergenic
1067684427 10:48458143-48458165 ACTGCTGAGATGGGGGTGGAGGG + Intronic
1070434016 10:76370839-76370861 CATTATAAGTTGAGGATGGAAGG + Intronic
1070690084 10:78517928-78517950 TCTTCTGAGAGGAGGTTGGGGGG + Intergenic
1070796762 10:79221457-79221479 CCTTCTGTACTGAGGAGGGAGGG - Intronic
1070820043 10:79349125-79349147 CCTTCTGAGATGGGTCTAGAGGG + Intronic
1071224318 10:83509913-83509935 CCTTCTGAGATGAGGTATGGTGG - Intergenic
1071575927 10:86726278-86726300 CTTTCTGAGAAGAGGCAGGAGGG + Intronic
1075100640 10:119503799-119503821 CCTTGTGAGAAGAGGAGGTAAGG - Intronic
1075333720 10:121594098-121594120 GACTCTGAGGTGAGGATGGAAGG - Intronic
1076055154 10:127366753-127366775 GCTTCTGGGATGGGGATGGTCGG + Intronic
1076322631 10:129594796-129594818 CCTTGTCAACTGAGGATGGAGGG - Intronic
1077260932 11:1619935-1619957 CCTTCTGGGAACAGGTTGGATGG - Intergenic
1077791699 11:5447893-5447915 TCTTCTGAGATGGGGGTTGAGGG - Intronic
1080086604 11:28290369-28290391 CCTTTGGACATGAGAATGGATGG + Exonic
1080242512 11:30142934-30142956 CCTTGTGAGTTGAGAAGGGATGG + Intergenic
1082768849 11:57190003-57190025 CCTTCTGTGATGACCAAGGATGG + Exonic
1082918412 11:58464829-58464851 CCTTATGGGGTGAGGTTGGAGGG + Intergenic
1083301796 11:61743542-61743564 CAGTCTGAGATGAGCCTGGAGGG + Exonic
1084417347 11:69040632-69040654 ACTTCCGAGATTAGGTTGGACGG + Intergenic
1084449646 11:69228598-69228620 GCTTCTGATTTGTGGATGGAAGG + Intergenic
1084587221 11:70069215-70069237 TCTTCTGAGATGTGGCTTGAAGG + Intergenic
1084673452 11:70621026-70621048 CCATCTGAAATGGGGATGGATGG + Intronic
1084799165 11:71530506-71530528 CCTTCTGGGAACAGGTTGGATGG + Intronic
1084979374 11:72821220-72821242 CCTGGTGTGGTGAGGATGGAAGG + Intronic
1086969825 11:93068243-93068265 TCTTGTAAGATGAGGAAGGAAGG - Intergenic
1090353747 11:126124983-126125005 CCTTCTCAGATGAACCTGGAGGG + Intergenic
1091324050 11:134670898-134670920 CAGTCTGAGATGAGGGTGGGTGG + Intergenic
1092607157 12:10133095-10133117 CCTTCTGAAATGAAGACGCAGGG + Intergenic
1092785463 12:12022535-12022557 CCACCTGAGATGGGGAGGGAAGG + Intergenic
1092960933 12:13596470-13596492 CCTTCTGAGATGAGGATGGAGGG + Intronic
1092978194 12:13766631-13766653 TCTTCTGAGATGAAAATGAAAGG - Intronic
1094438241 12:30445511-30445533 GCTTTTGAGGTTAGGATGGAGGG - Intergenic
1097394157 12:59053596-59053618 CCCTTGGACATGAGGATGGATGG - Intergenic
1098095536 12:66951475-66951497 TCTTGTGACATGAGGTTGGAGGG + Intergenic
1099789259 12:87310606-87310628 TCTAGTGAGATGAGCATGGAGGG - Intergenic
1099833220 12:87872799-87872821 CCTAATGAGATGAAAATGGATGG - Intergenic
1099869476 12:88328456-88328478 CATTTTGAGATGAGTTTGGATGG + Intergenic
1101150546 12:101878730-101878752 ACTACTTAGATAAGGATGGATGG - Intronic
1101238887 12:102818270-102818292 CCTACTGAGGAGAGGATAGAGGG - Intergenic
1102202919 12:111069986-111070008 GCTCCTGTGATGAGGATGGGAGG + Intronic
1102799279 12:115717516-115717538 TTTGCTGAGATCAGGATGGATGG - Intergenic
1103860997 12:124013802-124013824 CCTTATGAGAAGTGGATGGTAGG + Exonic
1104074360 12:125376576-125376598 CATTCTGAGATGAGGAAACAAGG - Intronic
1104559895 12:129834140-129834162 CATTCTGAGATGAAGAAGGAAGG - Intronic
1105613916 13:21995154-21995176 CCATTTGAGTTGAGAATGGAAGG - Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1108913882 13:55585233-55585255 ACTTCTGAGTTGAGAAAGGAAGG + Intergenic
1109177514 13:59174398-59174420 CCCTCTGTGATCAGGCTGGAGGG - Intergenic
1111854536 13:93621182-93621204 CTTTCTGAGATGAGCCTTGAGGG - Intronic
1112784603 13:102938207-102938229 ACTTCTGAGATGAGGTTCGTGGG + Intergenic
1115168213 14:30473521-30473543 CCTTCGGAAATGAGGAGGTAGGG + Intergenic
1115410270 14:33066280-33066302 CCAGCGGAGATGAGGATGGAAGG + Intronic
1117903828 14:60564222-60564244 CTTTCTCAGATGAGGAGGGCAGG + Intergenic
1118014408 14:61643690-61643712 CTTACTGAGATGAGAATGCAGGG + Intronic
1118600637 14:67469605-67469627 CCTTCCAGGAAGAGGATGGAGGG - Intronic
1120008186 14:79383723-79383745 CCTTCTGAGATGATAAAGCATGG - Intronic
1120755487 14:88240127-88240149 CCTTCTGTGATGAGGCAGGCAGG + Intronic
1121100079 14:91244514-91244536 GCTGCTGAAATCAGGATGGAGGG + Intronic
1121228751 14:92341037-92341059 CCTCCTCAGATGAGTATGCAGGG + Intronic
1121869859 14:97397175-97397197 CCTTCTGAGGTGAGTAATGAGGG - Intergenic
1122697998 14:103566866-103566888 ACTTCTGAGAGGAGGAGGGTTGG + Intronic
1125060593 15:35417408-35417430 CCTTCTTAATTGAGAATGGAAGG + Intronic
1128671213 15:69576025-69576047 CCTTCTGGGAAGTAGATGGAGGG + Intergenic
1129523749 15:76201359-76201381 CCTCCTGAGAGGAGCAGGGAGGG - Intronic
1130507784 15:84562416-84562438 ACTTCTGAGATGAGGCTACAAGG + Intergenic
1131524126 15:93139207-93139229 CCTACTGAGATGGGGAGAGATGG + Intergenic
1132428115 15:101737729-101737751 ACTTCTGAGATGAGGCTACAAGG + Intronic
1132866105 16:2093439-2093461 CCTTCTGAGGTGAGGAAAGGGGG + Intronic
1133040404 16:3057449-3057471 TCCTCTGAGATGGGGATGGTGGG + Intronic
1133248666 16:4465837-4465859 CCTTCAAAGATGAGGAGGGCCGG - Intronic
1133921210 16:10154751-10154773 GCTTCTGAGATGAGTTTTGAAGG + Intronic
1136627663 16:31472047-31472069 CCCGCTGAGATGGGGATGGGGGG - Exonic
1137792242 16:51184987-51185009 CATTCTGAGATGAGCATGACTGG - Intergenic
1137842287 16:51651465-51651487 CCTTCTGGGAGGAAGGTGGAGGG - Intergenic
1137927746 16:52557392-52557414 CACGCTGAGATGAGAATGGAGGG + Intergenic
1138465680 16:57187804-57187826 CCTGCTTAGATGGGGATGGTGGG + Intronic
1139636841 16:68263414-68263436 CCTGCAGAGAGGAGAATGGAAGG + Intergenic
1142836148 17:2588731-2588753 GATGCTGAGATGAGGAAGGACGG + Intergenic
1144683602 17:17211592-17211614 CCATCTGAGAGGAAGATGGCTGG - Intronic
1146000203 17:29126290-29126312 CCTTGTGAGAGGAGGAGGGACGG + Intronic
1147947226 17:44086901-44086923 TCCTCTGAGATGGGGAGGGATGG + Intronic
1148890935 17:50806542-50806564 CACTCAGAGATGAGTATGGAGGG + Intergenic
1149912303 17:60577757-60577779 TCTACTGAGCTGAGGAGGGAGGG + Intronic
1150174029 17:63031325-63031347 CCTTCTGTGGTTAGGATGAAAGG - Intronic
1152112177 17:78362966-78362988 CCTGCTGAGATGAGCAGGCAGGG - Intergenic
1152404024 17:80086471-80086493 CCTTGAGAGAGGAGCATGGAAGG + Intronic
1153687849 18:7564970-7564992 CCCTTTGAAATGTGGATGGAAGG + Intergenic
1153764711 18:8364623-8364645 CCCGCTGAGAAGAGGGTGGATGG - Intronic
1154400035 18:14027864-14027886 CCTTCTGAGAAGAGGACCAAAGG - Intergenic
1157568077 18:48693533-48693555 CCACCTGAGATGAGGATAAAGGG - Intronic
1157710891 18:49848974-49848996 GCTCCTGAGCTGAGGGTGGAAGG + Intronic
1160078373 18:75700038-75700060 CCTGCTGAGATAAAGATAGAGGG + Intergenic
1160123545 18:76151017-76151039 CCCTCTGAGTTGACCATGGAGGG + Intergenic
1160196522 18:76759739-76759761 TCTTCTGAGATGGGGGTGGTGGG + Intergenic
1161062338 19:2221577-2221599 TCTTCTGAGAACAGGAGGGAGGG + Intronic
1161968448 19:7561797-7561819 CCTTCTGTGCTCAGGATGGCTGG + Intergenic
1166130914 19:40745008-40745030 CCTGCTGGGAGGAGGAGGGAAGG - Intronic
1166984259 19:46649977-46649999 TTTGCTGCGATGAGGATGGAAGG - Intronic
1168313493 19:55473374-55473396 CCTCCTGGGATGGGGGTGGATGG + Intergenic
1168452013 19:56474099-56474121 CCTCCTGAGGTGAGGACGGCTGG + Exonic
925746634 2:7049134-7049156 CCCTCTGAGTTGAGGGTTGAAGG + Intronic
926072853 2:9914324-9914346 CCTTCTCTGATGAGGAGGCAGGG - Intronic
927399120 2:22690317-22690339 CATCCTGTGATGAGGAAGGAGGG - Intergenic
927465436 2:23332891-23332913 CCTTCTGGGATCAGTATGGGAGG - Intergenic
927853409 2:26513699-26513721 CCTTCCCAGGAGAGGATGGAGGG + Intronic
930235081 2:48881068-48881090 GGATCTGAGATGAGAATGGAGGG + Intergenic
933245204 2:79967260-79967282 CACACTGAGATGAGGATGGTTGG - Intronic
933688497 2:85161516-85161538 CCTCCTGGGATGGGGATGGCTGG + Intronic
933938939 2:87229477-87229499 CATTTGGAAATGAGGATGGAGGG + Intergenic
936006797 2:108896387-108896409 CCTACTGGGATGATGAAGGATGG - Exonic
938246132 2:129779346-129779368 CCTCTGCAGATGAGGATGGAGGG - Intergenic
938860070 2:135359015-135359037 CTTTCTGGGATGAGGAGGGCAGG - Intronic
939466227 2:142561369-142561391 CCATCTGAGATGTGGAGGAAGGG - Intergenic
939976529 2:148723019-148723041 CCTTCAGGGTGGAGGATGGAAGG + Intronic
940420032 2:153470245-153470267 CCTTCTCCTATGAGGATGCATGG + Intergenic
940594260 2:155769399-155769421 CCTTCTGAGGTGAGGTAGGAAGG + Intergenic
940722585 2:157298387-157298409 CCTTCTGAGATGTGGTGGAAGGG - Intronic
942538790 2:176994040-176994062 TCTTCTAAGATGAGGTTAGATGG + Intergenic
943353916 2:186826971-186826993 GCTTCTGACATAAAGATGGATGG - Intergenic
946593265 2:221275178-221275200 TCTTCTAAAATGTGGATGGATGG + Intergenic
946684363 2:222252622-222252644 CCCTCTGCCATGTGGATGGAGGG + Intronic
947753217 2:232543483-232543505 CCTCCTGAATTGAGGATGGGGGG - Intronic
948961378 2:241341119-241341141 CCTTCAGGGATCAGGAAGGAAGG - Intronic
1168861629 20:1049819-1049841 CCTTCTAAGGTGAGACTGGAAGG - Intergenic
1169891650 20:10459758-10459780 CCTTCTCAGGTGTGGATAGATGG + Intronic
1170029654 20:11931615-11931637 CCCTCTGAGAAGCAGATGGAAGG - Intergenic
1171171296 20:23017701-23017723 CCTTCTGAGCGAAGGATGGAGGG - Intergenic
1171275756 20:23855569-23855591 CCCTCTCAGGTGGGGATGGAAGG + Intergenic
1171382354 20:24743248-24743270 CCCGCTGAGATCTGGATGGATGG - Intergenic
1171458056 20:25282983-25283005 CCCTCTCAGAAGAGGAAGGAGGG + Intronic
1172208642 20:33182102-33182124 CATTCTGGGGTGTGGATGGAGGG - Intergenic
1172697209 20:36831124-36831146 CCTGCAGGGATGAGGAAGGAAGG + Intronic
1173264374 20:41465875-41465897 CCTTTAGAGAACAGGATGGAAGG - Intronic
1174188213 20:48721946-48721968 TCTGCTGAGCTGGGGATGGAGGG + Intronic
1174443189 20:50572582-50572604 GCTTATGAGATGAGGAAGGGTGG + Intronic
1175047279 20:56118929-56118951 CCTTATAAGATGAGGACGGTTGG - Intergenic
1175072907 20:56349696-56349718 CATTCTGAGAAGAGTGTGGAAGG - Intergenic
1175921032 20:62450804-62450826 GCTCCTGGGAGGAGGATGGAGGG - Intergenic
1177392748 21:20497921-20497943 CATTCTGAGATGTGGAGAGATGG + Intergenic
1177848909 21:26323372-26323394 CATTCTGAAATTAGAATGGAGGG + Intergenic
1178919282 21:36728167-36728189 ACTTCTGAGAGGTGGCTGGAAGG + Intronic
1179179312 21:39031771-39031793 GCTTCTGAGATGAGGCCTGATGG - Intergenic
1179553911 21:42160460-42160482 CCTTCCGAGGTGAGGATGTGGGG - Intergenic
1179571858 21:42283205-42283227 CCTTCTGAGGGGGGGATGGCGGG + Intronic
1180788307 22:18559015-18559037 CCTTCTGAGGTGAGGAAGCCCGG + Intergenic
1181233431 22:21436303-21436325 CCTTCTGAGGTGAGGAAGCCCGG - Intronic
1181245219 22:21498540-21498562 CCTTCTGAGGTGAGGAAGCCCGG + Intergenic
1182440826 22:30362860-30362882 TTTTCTGAGATGAGGGTGGTTGG + Intronic
1183002835 22:34875914-34875936 CCTTGTCTGATGAGGATGGAGGG + Intergenic
1183077646 22:35436901-35436923 AGTTCGCAGATGAGGATGGAAGG + Intergenic
1183334508 22:37238985-37239007 GCTTCTGGGCTGAGGATGGTAGG - Intronic
1183469308 22:37997191-37997213 CCTTCAGAGGAGGGGATGGAGGG - Intronic
1183890239 22:40921253-40921275 CCTTCTCAGACGGGGGTGGAAGG + Intronic
950169632 3:10829328-10829350 CCTGTAGAGATGAGGCTGGAAGG - Intronic
950380915 3:12614045-12614067 CCTTCAGAGATGTGGAAGAAAGG + Intronic
951046886 3:18049940-18049962 TGTTCTGAGATGAGTTTGGAAGG + Intronic
952040108 3:29251344-29251366 CCTCCTCAGCTGAAGATGGAGGG - Intergenic
952263644 3:31764941-31764963 CCTTTTGGGAGGATGATGGAAGG - Intronic
952890469 3:38037021-38037043 GCTGCTGAGATGAGGACTGAGGG + Intergenic
953869762 3:46616102-46616124 TCTTCTGTGAGGAGGAAGGAAGG + Intronic
953910953 3:46892807-46892829 CCTTCTGGGGTAGGGATGGAGGG + Intronic
954661144 3:52227555-52227577 CCCTCTGAGAGGTGGATGGAGGG - Intergenic
954793471 3:53149330-53149352 CCTCCTGAGGGGAGGAGGGAAGG - Intergenic
955467227 3:59249875-59249897 CATGCTGAAATGAGGGTGGATGG + Intergenic
956042986 3:65165878-65165900 CACTCTGAGATGAATATGGATGG - Intergenic
960265411 3:115615632-115615654 TGTTCTGAGATGAGGATGCCAGG - Intergenic
960285259 3:115821142-115821164 TTTTCAGAGATGTGGATGGAGGG - Intronic
960955664 3:123028550-123028572 CGTTCTCAGCTGAGGACGGAAGG + Intronic
961487997 3:127230745-127230767 CCTACTAAGATGGGGATGGTGGG - Intergenic
961800152 3:129441291-129441313 CCGTGTGAGATGAGGAGAGACGG - Intronic
962203812 3:133419140-133419162 CCTTCTGAGAAGAGGAAGTTTGG - Intronic
962355166 3:134687580-134687602 CCAGCAGAGATCAGGATGGAGGG + Intronic
962385110 3:134926638-134926660 GCTGCTGAGATGGGGCTGGAGGG + Intronic
962406827 3:135107608-135107630 TCTTCTGTGATGGGGATGGATGG - Intronic
962732710 3:138298664-138298686 CCTAAGGAGAAGAGGATGGAGGG - Intronic
962760129 3:138504076-138504098 CCTTCTGAGATGAAGAAAGGTGG + Intronic
964660370 3:159114126-159114148 TTTTCTGAGTTGAGGAAGGATGG + Intronic
967225483 3:187287231-187287253 GCTACTGAGATGAGGTGGGAAGG - Intronic
968684619 4:1949094-1949116 ACTTCTGAGATGAGACTGGAGGG - Intronic
969119918 4:4900615-4900637 CCTTCTGAAATGTGTATAGAAGG - Intergenic
969721848 4:8896403-8896425 CCTCCTGAGGTCAGGCTGGAGGG - Intergenic
971409000 4:26350623-26350645 CATTAAGAGGTGAGGATGGAGGG + Intronic
971870573 4:32232241-32232263 CCTTTTGAGAACAGGATGGTGGG - Intergenic
972002054 4:34049740-34049762 CCGTCTGGGATTGGGATGGAGGG + Intergenic
972041849 4:34612077-34612099 CCTTCAGAGATTAAGATGGTAGG + Intergenic
972392383 4:38626036-38626058 CCTTCTGAGATCACTATGGATGG + Intergenic
973168079 4:47102700-47102722 TGTTGAGAGATGAGGATGGAAGG + Intronic
976380489 4:84393105-84393127 CCTCCAGAGAGGAGGAGGGAGGG + Intergenic
979291612 4:118984636-118984658 CCATCTGAGGTGAAGCTGGAAGG - Intronic
980844888 4:138312666-138312688 CATTCTGAGATAAGGAGGGCTGG - Intergenic
981125860 4:141105571-141105593 GGCTCTGATATGAGGATGGAGGG - Intronic
982022837 4:151221409-151221431 CCTGCTCAGCTGAGGATGGCAGG + Intronic
982720470 4:158854638-158854660 CCTTCAGACATGAAGATTGAGGG + Intronic
985657136 5:1138016-1138038 ACTTCTGAGAAGAGGAGGGGCGG - Intergenic
985709840 5:1422094-1422116 CCTGCTGAGATGGGGAGGGCAGG - Intronic
985840183 5:2300097-2300119 CCTCATGAGATGGGCATGGAGGG + Intergenic
991413445 5:66367735-66367757 ACTTCAAAGATGAGGAAGGATGG + Intergenic
991564766 5:67993416-67993438 TCTTCTGAGCTGGAGATGGATGG + Intergenic
992321712 5:75619821-75619843 CCTTCTGAAAGGAAGAAGGAAGG - Intronic
993380003 5:87196035-87196057 CCTTCTGAGATGAGGAAGCTGGG + Intergenic
996709153 5:126526761-126526783 TCAGCTGAGATGAGAATGGAAGG - Intergenic
996769288 5:127068958-127068980 TCTTTGGAGTTGAGGATGGAGGG - Intronic
999203834 5:149834482-149834504 CCAGCTGAGACTAGGATGGAAGG + Intronic
999308961 5:150539172-150539194 CCTTCTGGCATGAGGGTGGTGGG - Intronic
1001225661 5:169942632-169942654 TCTTATGAGTTGAGGATGCAGGG + Intronic
1001242353 5:170080338-170080360 CCTTGTGGGTGGAGGATGGATGG + Intronic
1001247511 5:170116023-170116045 ACTTCTTAGATGAGAATTGAAGG - Intergenic
1003033509 6:2623204-2623226 CCATCTGAGGTTAGGATCGAGGG + Exonic
1003343632 6:5245258-5245280 TCTTATGTGATGAGGAAGGAAGG + Intronic
1003595038 6:7467108-7467130 CCTCCTGAGATGAGTCTGCATGG - Intergenic
1004322983 6:14647608-14647630 CCTTCAGAGATGAGAGTGGCAGG - Intergenic
1005070371 6:21856810-21856832 CTTTGTGAGCTGAAGATGGAGGG + Intergenic
1006569018 6:34985063-34985085 TCACCTGAGAGGAGGATGGAGGG - Exonic
1006911885 6:37568732-37568754 TATTCTGAGATGAGGAAGGCAGG + Intergenic
1007694853 6:43725537-43725559 CCTATTGTGATGAGGATGGGGGG + Intergenic
1011012025 6:82713541-82713563 CCTTCTGAGATGGGGCAGGGAGG - Intergenic
1012701483 6:102462063-102462085 GCTTCTGACTTGATGATGGATGG + Intergenic
1013548385 6:111182733-111182755 GCTCCTGAGATGAGGATGGCTGG - Intronic
1016673665 6:146738322-146738344 CCTTCAGAGTTGAGAATGAAAGG - Intronic
1016685618 6:146879471-146879493 CCCCCTGAGATAAGGATGAAAGG + Intergenic
1017236286 6:152120319-152120341 CCATCTCAGATGAGGGTGCAGGG + Intronic
1017492797 6:154958954-154958976 CTGTCAGAGATGAGGATGGCGGG - Intronic
1018059305 6:160078270-160078292 CCTGATGAAGTGAGGATGGATGG + Exonic
1019020847 6:168916568-168916590 CCCTCTGAGATGAGCCTGGGAGG + Intergenic
1019457796 7:1139755-1139777 ACTTCTGAGATTAGGGTGCAAGG - Intergenic
1020147670 7:5657083-5657105 GCTTCTGAGACAAGGCTGGATGG - Intronic
1020637941 7:10718908-10718930 CATTTTGAGATGAGGCTGGTTGG + Intergenic
1022923928 7:35041857-35041879 CCTCTTCAGATGAGGAAGGAAGG + Intergenic
1024663269 7:51520085-51520107 CCTTCTGAGAGGAGGCTGAGAGG - Intergenic
1027361807 7:77416612-77416634 CCTTCGGGGCTGAGGATAGAGGG + Intergenic
1027657224 7:80945469-80945491 ATTTATGATATGAGGATGGAAGG + Intergenic
1029822242 7:103157629-103157651 CCTCTTCAGATGAGGAAGGAAGG + Intergenic
1030820848 7:114088274-114088296 AGTTCTCAGAGGAGGATGGAGGG + Intronic
1031084594 7:117289995-117290017 TTTTCTGAGATGAGGAGGGCTGG + Intronic
1032463973 7:132131964-132131986 CCTTAAGTGATGAGGATGGGAGG + Intronic
1032669905 7:134073315-134073337 GTTTCTATGATGAGGATGGATGG - Intergenic
1033476805 7:141700856-141700878 CTTTCTGGGATGAGGTGGGATGG - Intronic
1034879713 7:154753786-154753808 GCTTCTTGGATGCGGATGGAGGG - Intronic
1034971633 7:155423234-155423256 CATTCTGCGATGGGGCTGGAAGG - Intergenic
1035675559 8:1453180-1453202 CCTACTGAGCCCAGGATGGAAGG + Intergenic
1041272181 8:56120116-56120138 CCTTATGAGATGTGGGTGAAGGG + Intergenic
1046507322 8:115152764-115152786 CCTTCTGAGGCGATGAGGGAGGG - Intergenic
1047338295 8:123956517-123956539 CCTACTGCGAAGATGATGGAGGG - Intronic
1047573833 8:126131554-126131576 CCATTTGAGATGAAGATGAAGGG - Intergenic
1047907154 8:129484391-129484413 CTTTATGAGATGAGGGTGGGGGG + Intergenic
1048314573 8:133352565-133352587 CCTGCTGACAAGTGGATGGATGG + Intergenic
1048497863 8:134949883-134949905 CCTTCTGTGGTCAGGATGGTGGG + Intergenic
1048617279 8:136090973-136090995 CCTTCATAGATTAGGAAGGAAGG + Intergenic
1048931733 8:139320734-139320756 CCGGCTGACAGGAGGATGGAGGG + Intergenic
1049376358 8:142291202-142291224 CTTTCTGAGATGAGGGTGGTGGG - Intronic
1049491588 8:142906490-142906512 CCTCCTGGGATGAGGAGGGTTGG - Intronic
1053484167 9:38439528-38439550 ACTCCTGAGATGAGGATGCCAGG + Intergenic
1055829024 9:80358751-80358773 TCTTCTGAAAGGAGGCTGGAAGG + Intergenic
1056019813 9:82430181-82430203 CCTTCTGAAGGGAGGCTGGAAGG + Intergenic
1056191689 9:84190541-84190563 CAGTATGAGATGAGGGTGGAAGG - Intergenic
1056282461 9:85055258-85055280 ACCTCTGAGATGAGGAAGGGGGG + Intergenic
1057072025 9:92106849-92106871 CCTTCTGAAGGGAGGCTGGAAGG - Intronic
1057793959 9:98142762-98142784 CCTTCTCAGCTGATGAGGGAAGG + Intronic
1057820671 9:98328139-98328161 GTTTGTGAGATGAGGCTGGAGGG - Intronic
1060820615 9:126659441-126659463 CCTGCTGGGATGAGGAGGGATGG - Intronic
1062253674 9:135610939-135610961 CCATCTGTGATCAGGATGGCAGG - Intergenic
1186425232 X:9459251-9459273 CCATATGAGATGAGGAAGGGGGG - Intergenic
1186464442 X:9774122-9774144 CTTTAAGAGATGAGGATGGGAGG - Intronic
1187359967 X:18616890-18616912 CCCTCTGAGAGCAGCATGGAAGG - Intronic
1187628900 X:21146190-21146212 ACTTCTGAGCTAAGGCTGGAAGG - Intergenic
1187824342 X:23319494-23319516 CTTCTTGAGATAAGGATGGATGG + Intergenic
1187983095 X:24780201-24780223 CCTTGTAAAATGAGGTTGGAAGG + Intronic
1189065708 X:37806065-37806087 CTTTCTGAGAAGAGGTTCGAAGG + Intronic
1191690417 X:63933210-63933232 ACTTTTGAGATGAGCATTGAGGG - Intergenic
1192998859 X:76541687-76541709 CCTTTTGAAATGCTGATGGATGG - Intergenic
1193279198 X:79627219-79627241 CCTTTGGAGATGATTATGGATGG - Intergenic
1194691734 X:96994360-96994382 CTTACTGCGATGAGGATGAATGG + Intronic
1199406559 X:147468669-147468691 CCATCTGTGATGCAGATGGAAGG + Intergenic
1199850875 X:151724328-151724350 ACTTCTAAGATGAGGATGCAGGG + Intergenic
1200223139 X:154401916-154401938 TCTTTGGAGAGGAGGATGGAAGG + Exonic
1202376148 Y:24239342-24239364 ACTTCTGAGATGAGGCTACAAGG + Intergenic
1202494632 Y:25430776-25430798 ACTTCTGAGATGAGGCTACAAGG - Intergenic