ID: 1092961527

View in Genome Browser
Species Human (GRCh38)
Location 12:13601030-13601052
Sequence CACTTTGAAAGGATGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 546
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 501}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092961519_1092961527 26 Left 1092961519 12:13600981-13601003 CCAGGCAAAGGAGAGGGGAACTG 0: 1
1: 0
2: 1
3: 22
4: 308
Right 1092961527 12:13601030-13601052 CACTTTGAAAGGATGGGGCTGGG 0: 1
1: 0
2: 1
3: 43
4: 501
1092961520_1092961527 -5 Left 1092961520 12:13601012-13601034 CCCACTGCAAGAAATACTCACTT 0: 1
1: 0
2: 1
3: 17
4: 191
Right 1092961527 12:13601030-13601052 CACTTTGAAAGGATGGGGCTGGG 0: 1
1: 0
2: 1
3: 43
4: 501
1092961521_1092961527 -6 Left 1092961521 12:13601013-13601035 CCACTGCAAGAAATACTCACTTT 0: 1
1: 0
2: 0
3: 18
4: 214
Right 1092961527 12:13601030-13601052 CACTTTGAAAGGATGGGGCTGGG 0: 1
1: 0
2: 1
3: 43
4: 501

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092961527 Original CRISPR CACTTTGAAAGGATGGGGCT GGG Intronic
900211410 1:1457919-1457941 CACTTTGAGAGGCTGAGGCAGGG - Intronic
900477849 1:2884303-2884325 CACATGGGAGGGATGGGGCTGGG - Intergenic
901097513 1:6694130-6694152 CTCTTAGAAAAAATGGGGCTGGG - Intronic
901888491 1:12241186-12241208 CACTTTGGGAGGCTGAGGCTGGG - Intronic
902329140 1:15722388-15722410 CACTTTGAGAGGATGAGGTGGGG - Intronic
902431326 1:16365932-16365954 CACTTTGGAAGGGTGAGGCGGGG - Intronic
902782929 1:18716239-18716261 GCCTTTGGAAGGATGGGCCTGGG + Intronic
902909844 1:19587512-19587534 CACTTTGGAAGGCTGAGGCAGGG + Intergenic
903150376 1:21403817-21403839 CACTTTGGAAGGCTGAGGTTGGG + Intergenic
903878515 1:26492719-26492741 CAGGTTGAAAGAGTGGGGCTAGG + Intergenic
903940476 1:26926842-26926864 CACTTTGGGAGGCTGAGGCTGGG - Intronic
904883383 1:33717352-33717374 CACTGGGAGAGGATGGGGCTTGG + Intronic
905144820 1:35879850-35879872 GACTTTGAGAGGCTGGGGCCAGG + Intronic
905195632 1:36275026-36275048 CACTTTGGGAGGCTGGGGCAGGG + Intronic
905450447 1:38052684-38052706 AACTCTGAAAGGCTGGGGCTAGG + Intergenic
905821644 1:40997237-40997259 CACTTTGAAAGGCTGAGGCGGGG - Intronic
906412645 1:45591598-45591620 CACTTTGAAAGGCTTAGGCAGGG - Intronic
906786469 1:48620184-48620206 GACTTTGCAAAGATGGGGATGGG + Intronic
907432277 1:54420012-54420034 CACTTTGGGAGGCTGAGGCTGGG - Intergenic
907637024 1:56145590-56145612 CACTTTGATTGGCTGGGGCCTGG + Intergenic
908278949 1:62509075-62509097 CACTTTGAAAGGCTGAGGTAGGG + Intronic
908438506 1:64130544-64130566 CACCTTGAAATGATGGCCCTGGG - Intronic
909645372 1:77911080-77911102 CACTTTGGAAGGCTGAGGCAGGG - Intronic
909821839 1:80073725-80073747 CACTTTGGGAGGCTGAGGCTGGG + Intergenic
910884095 1:91947928-91947950 CACTTTGGGAGGCTGGGGGTGGG - Intergenic
910965355 1:92802916-92802938 CACTTTGGAAGGCTGGGGAGGGG + Intergenic
911272746 1:95823432-95823454 CACTTTGGAAGGCTGAGGCAGGG - Intergenic
911634129 1:100214505-100214527 CACTTTGGGAGGCTGGGGCGGGG + Intronic
912775937 1:112506588-112506610 CCCTGTGTAGGGATGGGGCTGGG + Intronic
912791661 1:112657835-112657857 CACTTTGAGAGGCTGTGGCAGGG - Intronic
913571647 1:120126192-120126214 CACTTTAAAAGGCTGAGGCAGGG + Intergenic
914292568 1:146287813-146287835 CACTTTAAAAGGCTGAGGCAGGG + Intergenic
914553612 1:148738596-148738618 CACTTTAAAAGGCTGAGGCAGGG + Intergenic
915201917 1:154236443-154236465 CACTTTGAAAGGCTGAGGGCGGG - Intronic
915528508 1:156490350-156490372 AACTTTGAAGGGTTGGGGCTGGG - Intronic
915798959 1:158768103-158768125 GACATTAAAAGGATGGGGCATGG - Intergenic
915911249 1:159916933-159916955 CACTTTGGGAGGCTGAGGCTGGG + Intergenic
915953701 1:160206341-160206363 CAATCTGAAACCATGGGGCTGGG - Intronic
916735848 1:167606431-167606453 CACTTTGGAAGGCTGAGGCAAGG + Intergenic
917734597 1:177908958-177908980 CATTTTGGAAGGGTGGGGTTTGG - Intergenic
918162395 1:181913719-181913741 CACTGTTAAAAGATGGTGCTGGG + Intergenic
919322246 1:196058073-196058095 AACTTTGGAAGGAGGGGGCGTGG + Intergenic
919686009 1:200484207-200484229 CACTTTGGAAGGCTGAGGCAAGG + Intergenic
919742044 1:200986979-200987001 CACTTTGTAAGGATGGGAGCAGG - Exonic
919980782 1:202642039-202642061 CCCACTGAAAGGATGGGGGTGGG - Intronic
920023611 1:202975536-202975558 TATATTGAAAGAATGGGGCTGGG + Intergenic
920189703 1:204185653-204185675 CACTTTGGAAGGGTGAGGCGGGG - Intergenic
921386364 1:214573997-214574019 CAGTTTGAGAGGAAGGGTCTGGG + Intergenic
921663801 1:217841675-217841697 CACTTTGAGAGGATTGAGGTGGG + Intronic
922425429 1:225488104-225488126 CCCTTTGTAGGGATGGGGTTGGG - Exonic
923064562 1:230506109-230506131 CACTTTGGGAGGCTGAGGCTGGG + Intergenic
923547682 1:234934914-234934936 CACTTTGAAAGGCTGAAGTTGGG + Intergenic
923647539 1:235839400-235839422 CACTTTGGAAGGGTGGAGGTGGG - Intronic
924191323 1:241555840-241555862 CACTCTGAAAGGCTGAGGCCAGG + Intronic
1064281476 10:13955351-13955373 CACTTTGGAAGGCTGAGGCAGGG - Intronic
1064748488 10:18501646-18501668 CAATGTGAAAGGATGGGACATGG + Intronic
1065227784 10:23563067-23563089 CACTTTGGGAGGTTGGGGCAGGG + Intergenic
1065817324 10:29493927-29493949 CACTTTGGGAGGCTGAGGCTGGG + Intronic
1066961115 10:42229839-42229861 TACTGTGAAAGGCTAGGGCTAGG + Intergenic
1067237265 10:44461480-44461502 CACTTTGAGAGGCTGAGGCGGGG - Intergenic
1067821230 10:49532510-49532532 CACTTTGAAAGGAAGAAGATGGG + Intronic
1068211164 10:53922839-53922861 CACTTTGGGAGGCTGGGGGTGGG + Intronic
1068693789 10:59944326-59944348 CACTGTCAAGGGATGGAGCTTGG + Intergenic
1068991633 10:63157014-63157036 CCCTTCCAAAGGATGGGGCATGG - Intergenic
1069320241 10:67160679-67160701 CACTTTGAGAGGCTGAGGCAGGG - Intronic
1070125525 10:73618495-73618517 CACTTTGGGAGGATGAGGCGGGG + Intronic
1071393274 10:85196513-85196535 CACTTTGGGAGGCTGGGGCTGGG - Intergenic
1072146053 10:92639340-92639362 CACTTTGAGAGGCTGAGGCAGGG + Intronic
1073141930 10:101253971-101253993 GACTCTGAAAGGATGGGGGTAGG - Intergenic
1074935014 10:118169624-118169646 CACTTTGGGAGGATGAGGCGGGG + Intergenic
1075162377 10:120035512-120035534 CATTTTGGAAGGATGGAGATGGG + Intergenic
1075939361 10:126375991-126376013 CACTTTGAGAGGCTGGGGGGTGG - Intronic
1076435135 10:130435432-130435454 AATTGTGATAGGATGGGGCTGGG + Intergenic
1076999197 11:314213-314235 GACCTTGGAAGGATGGTGCTGGG - Exonic
1079028882 11:16970411-16970433 CACTTTGGAAGGCTGAGGCAGGG + Intronic
1079892302 11:26071296-26071318 CACTTTGGAAGGCTGAGGCAGGG + Intergenic
1081000522 11:37664967-37664989 CACTTTGGGAGGCTGAGGCTGGG + Intergenic
1081974509 11:47223857-47223879 CACTTTGAGAGGCTGAGGCTGGG + Intronic
1082064719 11:47890745-47890767 CACTTTGGGAGGCTGGGGCGGGG + Intergenic
1082927829 11:58569633-58569655 CACTTTGGAAGGCTGAGGCGGGG - Intronic
1083095679 11:60248603-60248625 GCCTTTGGATGGATGGGGCTGGG - Intergenic
1083762090 11:64824243-64824265 GGCTTAGAAAGGCTGGGGCTGGG + Exonic
1084006604 11:66326615-66326637 CAGGAAGAAAGGATGGGGCTGGG - Intergenic
1084269321 11:68020709-68020731 CACTGTGCCAGGATGGGGCAGGG + Intronic
1085053505 11:73391492-73391514 CTCTTTGAAGGGATGGGGACAGG - Intronic
1085121536 11:73970433-73970455 CACTTTGATAGAGTGGGGCAGGG + Intergenic
1085606281 11:77902358-77902380 CACATTGGAAGGATGGGACCAGG - Intronic
1085625531 11:78069133-78069155 CACTTTGAGAGGCTGAGGCAGGG - Exonic
1085807813 11:79652393-79652415 CACTTGGTAACTATGGGGCTTGG - Intergenic
1088281111 11:108135611-108135633 CACTTTGGGAGGCTGAGGCTGGG + Intronic
1088323855 11:108582216-108582238 CACTTTGGGAGGCTGGGGCGGGG + Intronic
1089544503 11:119212763-119212785 CACTTTGGGAGGCTGAGGCTGGG + Intronic
1089559008 11:119334287-119334309 CTCTTTTAGAGGGTGGGGCTAGG + Intergenic
1090143249 11:124289145-124289167 CACTTTGGAAGGCTGAGGCAGGG - Intergenic
1090612993 11:128488488-128488510 CACAGGGAAAGGATGGGCCTGGG + Intronic
1090751277 11:129748422-129748444 CACCTTGAAGGGAGAGGGCTGGG + Intergenic
1091595149 12:1873351-1873373 AACTTTGAAAGGATGGGCAGAGG + Intronic
1091639633 12:2225970-2225992 CACTTTGAAAGGAAAGCTCTAGG + Intronic
1092602264 12:10080061-10080083 CACTTTGGGAGGCTGGGGCAGGG + Intronic
1092961527 12:13601030-13601052 CACTTTGAAAGGATGGGGCTGGG + Intronic
1093473314 12:19528368-19528390 CACTTTGAGAGGCTGAGGCAGGG + Intronic
1094450760 12:30581065-30581087 CACTTTGAAAGGGCGAGACTGGG - Intergenic
1095328810 12:40932046-40932068 CATTTTTAAAGGATGGAGCATGG - Intronic
1096226569 12:49870019-49870041 CACTTTGTAAGAAAGGGGGTAGG - Exonic
1096343865 12:50828330-50828352 CACCTTGAAGGGAAGGGCCTTGG - Intergenic
1098785092 12:74743268-74743290 CACTTTGGGAGGCTGAGGCTGGG + Intergenic
1099448835 12:82784297-82784319 CACTTTGAAAGGCATTGGCTAGG + Intronic
1100344626 12:93715894-93715916 CACTTTGAGAGGCTGAGGCGGGG + Intronic
1100601881 12:96118735-96118757 CACTTTGGAAGGCTGAGGCAGGG - Intergenic
1100659033 12:96677255-96677277 CACTTTGGGAGGATGAGGCAGGG - Intronic
1101134153 12:101722605-101722627 CACTTTGAGAAGCTGAGGCTGGG + Intronic
1102792462 12:115658705-115658727 CACCTTTAATGGATGGGGCTGGG - Intergenic
1103801790 12:123542839-123542861 CACTTTGGGAGGCTGGGGGTGGG - Intergenic
1105901185 13:24754642-24754664 CACTTTGGGAGGCTGAGGCTGGG + Intergenic
1107854929 13:44605525-44605547 CACTTTGAGAGGCTGAGGCAGGG + Intergenic
1108337042 13:49454175-49454197 CACTTTGAAAGGCCGAGGCCAGG + Intronic
1108436284 13:50404645-50404667 CTCTTTGACAGCTTGGGGCTAGG + Intronic
1111169067 13:84501659-84501681 CACTTTGAGAGGCTGAGGCGGGG + Intergenic
1111791828 13:92866761-92866783 AATTTAGAAAGGAAGGGGCTTGG - Exonic
1113504583 13:110806508-110806530 CACTTTGGGAGGCTGAGGCTGGG - Intergenic
1115263043 14:31473001-31473023 CACTTTGGGAGGCTGGGGCAGGG - Intergenic
1116130013 14:40844053-40844075 CACTTTGAGAGGCTGAGGCGGGG + Intergenic
1116436852 14:44904756-44904778 AACTTATAAAAGATGGGGCTAGG - Intronic
1117914340 14:60661184-60661206 CACTTTGGAAGGCTGAGACTCGG - Intergenic
1118095653 14:62534401-62534423 CAGTTTCAAAGAATGTGGCTAGG + Intergenic
1118262898 14:64264623-64264645 CACTTTGAGAGGCTGAGGCAAGG + Intronic
1118398891 14:65361540-65361562 CACTTTGGGAGGCTGAGGCTGGG + Intergenic
1118592161 14:67410044-67410066 CCCTTGGAAAAGACGGGGCTTGG - Intronic
1119840852 14:77791789-77791811 CATTCTGTAAGGATAGGGCTGGG - Intergenic
1120898507 14:89556156-89556178 CACTTTGGGAGGCTGGGGCGGGG + Intronic
1121967442 14:98323739-98323761 TACTGTGAAATGATGGGGATGGG + Intergenic
1122231604 14:100308888-100308910 CACTTTGCAAGGAGAGGGCAGGG + Intergenic
1122551168 14:102550780-102550802 CACTTTGGAAGGCTGAGGCGGGG + Intergenic
1122583446 14:102786737-102786759 CACTTTGAGAGGATGAGGCGGGG + Intronic
1124026355 15:25969954-25969976 CACTTTGGAAGGCTGAGGCAGGG - Intergenic
1124060493 15:26289506-26289528 CACTTTCACAGCGTGGGGCTCGG + Intergenic
1124461348 15:29895007-29895029 CAATTTGAAAGGATGGGCCAAGG - Intronic
1125559799 15:40620152-40620174 CACTTTGGAAGGCTGAGGCAGGG - Intronic
1125686168 15:41564581-41564603 CCCTTTGAGGGGATGGGGGTGGG + Intronic
1126140939 15:45438061-45438083 CACTTTGGAAGGGTGAGGCTGGG + Intronic
1127245890 15:57173949-57173971 CACTTTGAGAGGCTGAGGCGGGG - Intronic
1127433958 15:58938284-58938306 CACTTTGAGAGGCTGAGGCTAGG - Intronic
1127755500 15:62087975-62087997 CACTCTGACAGGAGGTGGCTTGG - Intergenic
1128131353 15:65229158-65229180 CACTTTGAAAGGCTGAGACCAGG - Intergenic
1128388911 15:67169706-67169728 CACTTTGAGAGGCTGAGACTGGG - Intronic
1128420559 15:67488064-67488086 CACTTTGGGAGGCTGAGGCTGGG + Intronic
1129314969 15:74736490-74736512 CACTCTGTGAGGCTGGGGCTGGG - Intergenic
1129416631 15:75386712-75386734 CACCATGGAAGGATTGGGCTGGG - Intronic
1129797522 15:78389405-78389427 CAGTTTGAGAGGAGGGAGCTGGG - Intergenic
1130565049 15:84986858-84986880 CACTTTGGTAGGCTGAGGCTGGG - Intronic
1131878491 15:96837306-96837328 CACTTTGAGAGGCTGAGGTTGGG + Intergenic
1133004814 16:2873928-2873950 CACTTTGAAAGGCTTGAGGTAGG - Intergenic
1133091736 16:3409912-3409934 CACTTTGAGAGGCTGAGGCAGGG + Intronic
1133142786 16:3760335-3760357 CACTTTGGAAGGCTGAGGCAGGG - Intronic
1133337197 16:5013936-5013958 CACTTTGAAAGGCTGAGGCAGGG - Intronic
1133345621 16:5068378-5068400 CACTTTGAGAGGCTGAGGCGGGG + Intronic
1133764472 16:8827639-8827661 CACTTTGAGAGGCTGAGGCAGGG - Intronic
1134680825 16:16124085-16124107 CACTTTGAAATGAAGAGTCTGGG + Intronic
1134804070 16:17109922-17109944 CACTCTGAAAGCATGAAGCTTGG + Intronic
1135935581 16:26777153-26777175 CCCATTCATAGGATGGGGCTGGG - Intergenic
1137265455 16:46865504-46865526 CACTTTGGGAGGCTGAGGCTGGG - Intergenic
1137694741 16:50454079-50454101 CACTTTGGAAGGCTGAGGGTGGG - Intergenic
1139120141 16:64006148-64006170 CACTTTGAAAGGCCAAGGCTAGG - Intergenic
1140212506 16:72981808-72981830 CCCTTTGGAAGGCTGGTGCTGGG - Intronic
1140748970 16:78006149-78006171 CACTTTGAAAGGAGGGAGCAGGG - Intergenic
1140794716 16:78426513-78426535 TAGTTTGAAAGGAAGGGACTTGG + Intronic
1141335826 16:83154309-83154331 CACTTTGGGAGGCTGAGGCTGGG + Intronic
1142266590 16:89066810-89066832 CACTCTGAGAGGACGGGGCGGGG - Intergenic
1142320013 16:89375699-89375721 CACTTTGGGAGGCTGAGGCTGGG - Intronic
1142341736 16:89527847-89527869 CACTTTGGAAGGCTGAGGCAGGG + Intronic
1142504497 17:354197-354219 CACTTGGGAAGGCTGAGGCTTGG + Intronic
1142707092 17:1702288-1702310 CACTTTGGGAGGCTGAGGCTTGG - Intergenic
1142730024 17:1847773-1847795 CACTTTGAGAGGCTGAGGCGGGG + Intronic
1142734317 17:1885682-1885704 CACTTTGAGAGGTTGAGGCAGGG - Intronic
1143175389 17:4952033-4952055 CACGTTGGAAGAAGGGGGCTTGG - Intronic
1144710409 17:17398110-17398132 GTCTTTGCAAGGATGGGCCTGGG + Intergenic
1144839046 17:18174374-18174396 CACTTTGGAAGGCTGAGGCAAGG + Intronic
1145074509 17:19840629-19840651 CACTTTGGGAGGATGAGGCGGGG + Intronic
1146292892 17:31624120-31624142 CTCTTTGAAAGAATGAGGCCAGG + Intergenic
1146410910 17:32584047-32584069 CACTTTGGGAGGCTGAGGCTGGG - Intronic
1146706635 17:35005100-35005122 CAGTTTGAAGGGAGGGGACTAGG + Exonic
1146818108 17:35961029-35961051 CACTTTGGGAGGCTGGGGGTGGG + Intergenic
1147457351 17:40546082-40546104 CAATGTGAAGGGAAGGGGCTTGG - Intergenic
1147666204 17:42150128-42150150 CACTTTGGAAGGCTGAGGCTGGG - Intronic
1147945225 17:44076995-44077017 CACTATGAACCGATGGTGCTGGG + Exonic
1148873152 17:50670326-50670348 CACTTTGAGAGGCTGAGGCGGGG - Intronic
1149495783 17:57116468-57116490 CACTTTTGAAGGATGATGCTGGG - Intronic
1151472128 17:74325235-74325257 CACTTTCCAGGGAAGGGGCTGGG - Intergenic
1151593295 17:75061201-75061223 GACTGTGGTAGGATGGGGCTGGG - Intronic
1151949251 17:77340384-77340406 CACTTTTGAAGGCTGGGGCGGGG - Intronic
1152019632 17:77773769-77773791 CACTTTGGGAGGCTGGGGGTGGG - Intergenic
1152721028 17:81923893-81923915 AACTTTGAAAAGCTGGGGGTGGG + Intronic
1152960386 18:76184-76206 CACTTTGAGAGGCTGAGGCGGGG + Intergenic
1153527710 18:6013555-6013577 CACTGGGCAAGGGTGGGGCTAGG - Intronic
1153653756 18:7263918-7263940 CACTTGGGAAGGGTGGGGGTGGG + Intergenic
1154239932 18:12643941-12643963 CACTTTGGAAGGCTGGGGGTGGG + Intronic
1154491305 18:14924492-14924514 AACTCTGAGAGGATGGAGCTTGG - Intergenic
1155252591 18:23966364-23966386 CACTTTGAGAGGCCGAGGCTGGG + Intergenic
1155641032 18:28015424-28015446 CACTTTTAAATCATGGGGCATGG - Intronic
1155937033 18:31764778-31764800 CACTTTGGGAGGCTGAGGCTGGG - Intergenic
1156049332 18:32913274-32913296 CACTTTGCAAGGCTGAGGCAGGG + Intergenic
1156714002 18:39984129-39984151 CACTTTGAGAGGCTGAGGCGGGG + Intergenic
1157061163 18:44292392-44292414 AACTCTGAAATGATGGGGTTAGG + Intergenic
1158765765 18:60447915-60447937 CACTGTGTTAGTATGGGGCTGGG + Intergenic
1158849554 18:61481793-61481815 CACTTTGGAAGGCTGGGTATGGG - Intronic
1158958625 18:62567696-62567718 CACTTTGGGAGGCTGGGGCCCGG + Intronic
1160287124 18:77554085-77554107 GAATATCAAAGGATGGGGCTGGG - Intergenic
1161259318 19:3327893-3327915 CACTTTGGGAGGCTGAGGCTGGG - Intergenic
1161337691 19:3722998-3723020 AACTCTGAGAGGGTGGGGCTTGG - Intronic
1161462492 19:4406676-4406698 CACTTTGAAAGGCTGAGGCAGGG - Intronic
1161502011 19:4621487-4621509 CACTTTGGAAGGCTGAGGCGGGG - Intergenic
1161750304 19:6091244-6091266 CACTTTGGGAGGCTGAGGCTGGG + Intronic
1161842732 19:6692799-6692821 CCCTTTGCAAAGATTGGGCTGGG - Intronic
1161848138 19:6724113-6724135 CACTTTGGGAGGCTGAGGCTGGG + Intronic
1161866936 19:6839935-6839957 CACTTTGAGAGGCTGAGGCAGGG - Intronic
1162059537 19:8086205-8086227 CACTCGGTAAGGGTGGGGCTGGG + Exonic
1162228366 19:9243728-9243750 CACTTTCAAAGGATGATGCAAGG - Intergenic
1163056157 19:14719938-14719960 CACTTTGGGAGGCTGAGGCTGGG + Exonic
1163403252 19:17107363-17107385 CACTTTGAGACCCTGGGGCTGGG - Intronic
1163406626 19:17126927-17126949 CACTTTGGAAGGCCGGGGGTGGG - Intronic
1163619272 19:18348453-18348475 CACCGTGAAAGGACGGGGCTCGG - Intronic
1163822614 19:19504888-19504910 CACTTTGAGAGGCTGGGGGGTGG - Intronic
1164685042 19:30161032-30161054 CACTTAGAAATGATGGGCATGGG - Intergenic
1164902212 19:31938031-31938053 CACTTGGACAGTATGGTGCTGGG - Intergenic
1165039157 19:33056785-33056807 CACTGTGGAAGGCTGAGGCTTGG + Intronic
1165103275 19:33452861-33452883 AACTTGGAAAGCATAGGGCTTGG - Intronic
1165482961 19:36076310-36076332 CACTTTGGAAGGCTGGGGCAGGG + Intronic
1166088627 19:40493454-40493476 CACTTTGGGAGAATGAGGCTAGG + Intronic
1167001821 19:46749961-46749983 CACTTTGGGAGGATGAGGCTGGG - Intronic
1167007270 19:46784229-46784251 CACATTGAAAGGATGTGGAAGGG - Intronic
1167151135 19:47710558-47710580 CACTTTGGGAGGCTGGGGCAGGG - Intergenic
1167993019 19:53376722-53376744 CACTTTGGAAGGCCGGGGGTGGG + Intronic
1168251768 19:55146060-55146082 TACATTCAAAGGTTGGGGCTTGG - Intronic
1168634620 19:57986239-57986261 CACTTTGAGAGGCTGAGGCAGGG + Intronic
927129052 2:20041779-20041801 CACTTTGGGAGGCTAGGGCTGGG - Intronic
927396479 2:22656811-22656833 CACTTTGAGAGGCTGAGGCAGGG + Intergenic
927459734 2:23287575-23287597 CACTTTGAAAGGAGGGTGAAGGG + Intergenic
927795155 2:26041608-26041630 GAAATTGAAAGGTTGGGGCTGGG + Intronic
928647539 2:33370423-33370445 CACTTGCAAAAGATGGGGCGGGG + Intronic
928985272 2:37174441-37174463 CACTTTGAGAGGCTGAGGCAGGG - Intronic
929124594 2:38511663-38511685 CACTTTGAGAGGCTGAGGCGGGG - Intergenic
929187940 2:39114545-39114567 CACTTTGAGAGGCTGAGGCGGGG - Intronic
929370920 2:41223036-41223058 CACTGAGAAAGGATGGGTCAGGG - Intergenic
929876088 2:45797745-45797767 CAATTGAAAAAGATGGGGCTGGG - Intronic
930193913 2:48489583-48489605 CACTTTGAGAGGCTGAGGCAGGG - Intronic
930212421 2:48654627-48654649 CACTTTGAGAGGCTGAGGCAGGG - Intronic
930685876 2:54307764-54307786 CACTTTGGAAGGCTGAGGCAGGG - Intergenic
930727127 2:54693238-54693260 GATTTGGAAAGGATGGGGCCAGG - Intergenic
930994533 2:57700331-57700353 CTATTTTAAAGGAAGGGGCTAGG - Intergenic
931220194 2:60282575-60282597 AACTGTGAGAGGATGGGGGTGGG - Intergenic
931322082 2:61181214-61181236 CACTTTGAAAGGCTGTGGTGAGG - Intronic
931655260 2:64505039-64505061 CACTGTGAGAGGATGGAGCGGGG - Intergenic
931989983 2:67780428-67780450 CACTTTGGGAGGCTGAGGCTGGG + Intergenic
932107758 2:68962424-68962446 CACTTTGAGAGGCTGAGGCAGGG - Intergenic
933507213 2:83192690-83192712 TACTTTGGAAGGCTGAGGCTAGG - Intergenic
933691200 2:85180925-85180947 CCCTTAGGAAGGCTGGGGCTAGG - Intronic
933882587 2:86685053-86685075 CACTTTGGGAGGCTGAGGCTGGG - Intronic
933906536 2:86899366-86899388 CACTTTGAAAGCCTGAGGCCTGG + Intergenic
934024938 2:87994280-87994302 CACTTTGAAAGCCTGAGGCCTGG - Intergenic
934865303 2:97804362-97804384 CACTTAGAAAGGAAGGGGGTGGG + Intronic
935165293 2:100564111-100564133 CACTTTGGGAGGCTGAGGCTGGG - Intronic
935193077 2:100793799-100793821 GGATTTGTAAGGATGGGGCTGGG - Intergenic
935299652 2:101682909-101682931 CACTTTGGAAGGCTGAGGCGGGG + Intergenic
935710273 2:105892588-105892610 CAATTTGGAAGGCTGAGGCTGGG + Intronic
936453402 2:112650865-112650887 CACTTTGGGAGGATGAGGCAGGG - Intronic
937990548 2:127659725-127659747 GAATCTGAAAGGCTGGGGCTGGG - Intronic
938380128 2:130831901-130831923 CACATTGACTGGAAGGGGCTTGG - Intergenic
938387007 2:130873762-130873784 CACTTTGGAGGGGTGGGGTTTGG + Intronic
938427658 2:131205055-131205077 CACTTTGAGAGGCTGGGGTGGGG + Intronic
938827028 2:135016003-135016025 CACTTTGGGAGGATGAGGCAGGG + Intronic
939248732 2:139659795-139659817 CACTTTGGTAGGCTGGGGCTGGG + Intergenic
939540159 2:143484116-143484138 CACTTTGGGAGGCTGGGGGTGGG + Intronic
941648426 2:168066972-168066994 CACTTTGAAAGGATGAGGTGTGG + Intronic
941989464 2:171541007-171541029 CACTTTGAGAGGCTGAGGCGGGG - Intronic
942165972 2:173241365-173241387 CACTTTGGGAGGCTGAGGCTGGG + Intronic
942238822 2:173940121-173940143 CACTTTGGGAGGCTGAGGCTGGG - Intronic
942318601 2:174716619-174716641 CACCTTGAGAGGCTGAGGCTGGG - Intergenic
942351474 2:175057595-175057617 CACACAGAAAGGATGGGGGTGGG - Intergenic
942482846 2:176407497-176407519 CACTTTGAGAGGCTGGGGGAGGG - Intergenic
942666286 2:178322291-178322313 CAACCTGAAAGGATGGGGATCGG + Intronic
943684140 2:190798985-190799007 CACTTTGAAAGGCTGAGGTAAGG - Intergenic
943770907 2:191715598-191715620 ATCTCTGAAAGGAAGGGGCTTGG + Intergenic
943958911 2:194233527-194233549 CAGTTTGGAAGGATACGGCTAGG - Intergenic
944258214 2:197646802-197646824 CACTTTGGAAGGCTGAGGCAGGG + Intronic
945862786 2:215142833-215142855 TACTTTGAAAGCATAAGGCTAGG + Intergenic
946092290 2:217238655-217238677 CACTTTGAAAGGCAGAGGCAGGG - Intergenic
946770812 2:223086464-223086486 CACTTTGCAGAGATGGAGCTGGG - Intronic
946918561 2:224552716-224552738 CAATGTGAAAAGATGGGTCTTGG + Intronic
947217973 2:227766903-227766925 CACTTTGGGAGGATGAGGCAAGG + Intergenic
947221936 2:227802202-227802224 CACTTTGAGAGGCTGAGGCCAGG + Intergenic
947225100 2:227832250-227832272 CACTTTGAGAGGGTGAGGCAGGG + Intergenic
947557843 2:231112917-231112939 CACTTTGGGAGGCTGGGGCAGGG + Intronic
947601569 2:231454096-231454118 CACTTTGGAACCTTGGGGCTGGG - Exonic
947858567 2:233341821-233341843 CACTTTAAAATGATGAAGCTGGG + Intronic
947990192 2:234481045-234481067 CACTTTGGAAGGCCGAGGCTAGG - Intergenic
948861873 2:240756662-240756684 CCCTCTGAAATGATGGGGCCTGG - Intronic
1168788752 20:561965-561987 CGCTTTGGAAGGCTGGGGCCAGG - Intergenic
1168955167 20:1829615-1829637 TGCTGTGAAAGGATGGGGCAGGG + Intergenic
1169108467 20:3017604-3017626 CACTGCACAAGGATGGGGCTGGG - Intronic
1172183968 20:33020070-33020092 CTCTCTGAAAGGATGGCGCCTGG + Intronic
1172292501 20:33786247-33786269 CACTTTGGGAGGCTGGGGCGGGG - Intronic
1172416319 20:34771378-34771400 CACTTTGGAAGGCTGAGGCCAGG - Intronic
1172874142 20:38154061-38154083 CACTTTGAGAGGCTGAGGCAGGG - Intronic
1173259660 20:41422390-41422412 CACTTTGAGAGGCAGAGGCTAGG + Intronic
1173286274 20:41673985-41674007 CACTTTGAGAGGCTGAGGCGGGG - Intergenic
1174219420 20:48941345-48941367 CACTCTGCAAGCATGGTGCTAGG + Intronic
1175366158 20:58457719-58457741 CACGTTGAAAGGTGGGGGGTGGG - Intergenic
1178546958 21:33500459-33500481 CACTTTGGGAGGATGAGGCAGGG - Intergenic
1178776828 21:35559482-35559504 GACTTTGAAAAGATGGGAATTGG + Intronic
1178979869 21:37254563-37254585 CACTTTGGGAGGCTGGGGCAGGG + Intronic
1179066975 21:38034245-38034267 CACTTTGAGAGGCTGAGGCAGGG + Intronic
1180201116 21:46224863-46224885 CACTTTGGGAGGCTGGGGGTGGG + Intronic
1180616605 22:17132420-17132442 CACTTTGGAAGGCTGAGGCAGGG + Intergenic
1180732917 22:17995425-17995447 CACTTTGAGAGGCTGGGCCAAGG - Intronic
1180867494 22:19127736-19127758 CGGTTTGAAGGGATGTGGCTTGG - Intergenic
1181186097 22:21105031-21105053 CACTTTGGGAGGATGAGGCATGG + Intergenic
1181280583 22:21717118-21717140 CACTTTGGGAGGCCGGGGCTGGG + Intronic
1181452964 22:23036126-23036148 CACTTTGAGAAGCTGGGGGTGGG + Intergenic
1182291861 22:29286260-29286282 CACTTTGGAAGGCTGAGGCTGGG - Intronic
1183257304 22:36770823-36770845 CACTGTGGAAGGATGGGCTTGGG - Intronic
1184059177 22:42071643-42071665 CACTTTGGAAGGCTGAGGCAGGG + Intergenic
1184475070 22:44715892-44715914 CACTTTGAGAGGCTGGAGGTGGG - Intronic
1184969589 22:48006234-48006256 CACTTTGAAAGGCTGAGGCAGGG - Intergenic
1185183210 22:49375617-49375639 CACTTTGGAAGGCTGAGGCAGGG - Intergenic
949313940 3:2730801-2730823 GAATCTGAATGGATGGGGCTGGG - Intronic
949463139 3:4315749-4315771 AAATTTTAAAAGATGGGGCTGGG + Intronic
949916332 3:8967481-8967503 CACTTTGGAAGGCTGAGGCTGGG - Intergenic
950105187 3:10384163-10384185 CACTTTGAATGCAGGTGGCTTGG + Intronic
950219396 3:11183136-11183158 CACTTTAAAAAGGTGGGACTGGG - Intronic
950986954 3:17382805-17382827 CACTTTGTAAGGCTGAGGCAGGG - Intronic
951513272 3:23528414-23528436 CACTCTGAAAAGATGAGGCAGGG + Intronic
951643013 3:24856882-24856904 CACATTGAAATGATGGGGGCAGG + Intergenic
951664244 3:25104375-25104397 CACTTTGGAAGGCCGGGGATGGG + Intergenic
953169691 3:40495974-40495996 CACTTTGAGAGGCTGAGGCGGGG - Intergenic
953690434 3:45113143-45113165 CAGTTTTAAAGGATGGATCTTGG - Intronic
953823201 3:46227127-46227149 CACTTTGAGAGGCTGAGGCAGGG - Intronic
953913355 3:46903836-46903858 CACTCCGAGAGGGTGGGGCTGGG + Intergenic
954085844 3:48243201-48243223 CACTTTGGAAGGCTGAGGCTAGG + Intronic
954557365 3:51528636-51528658 CACTTTGGAAGGGTGAGGCAAGG + Intergenic
955424466 3:58773303-58773325 CACTTTGGGAGGCTGAGGCTGGG + Intronic
955546188 3:60033248-60033270 CACTTTGAGAGGCTGAGGCGGGG + Intronic
957834954 3:85575254-85575276 CTCTTTAAAATGATTGGGCTGGG + Intronic
957846337 3:85741422-85741444 CACTTTGGAAGGCCGGGGCGGGG + Intronic
958915077 3:100040736-100040758 CATTTTGAGAGGGTGGTGCTGGG + Intronic
960816365 3:121677300-121677322 CACTTTGAGAGGCTGAGTCTGGG + Exonic
960922256 3:122759097-122759119 CAGGCTGACAGGATGGGGCTGGG + Intronic
961156733 3:124685940-124685962 AACTTTGACAGCATGGGGGTGGG - Intronic
962287915 3:134103845-134103867 CACTTTGAAAAGATGGAGCTGGG - Intronic
962374823 3:134850959-134850981 CACAATGGAAGGATGGGCCTTGG + Intronic
962521665 3:136202815-136202837 CACTTTGGGAGGCTGAGGCTGGG - Intergenic
963166016 3:142204261-142204283 CACTTTGGAAGGCTGAGGCAGGG - Intronic
963298241 3:143571116-143571138 CACTTTGAAAGGTCAGGGCCTGG + Intronic
963603970 3:147398432-147398454 CACTTTGGCGGGATGGGGGTCGG + Intronic
964773945 3:160255155-160255177 CACTTTGGAAGGCTGAGGCAGGG - Intronic
965601256 3:170456810-170456832 CACTTTGGAAGGGTGAGGCAGGG - Intronic
966834065 3:184035936-184035958 CACTTTGGAAGGCTGAGGCGGGG - Intronic
967052824 3:185800491-185800513 CACTTTGCAAGGCTGAGGCAAGG + Intronic
967086729 3:186101796-186101818 AGCTGTGAAAGGAGGGGGCTGGG + Intronic
967517717 3:190390239-190390261 CACATTTAAAGGAAGAGGCTGGG + Intronic
968418988 4:466916-466938 TAATTTAAAAGGATGCGGCTTGG + Intronic
968832426 4:2939906-2939928 CTCTCTGAAAGGAGGGGACTTGG + Intronic
969757524 4:9159703-9159725 CACTTTGGGAGGCTGAGGCTGGG + Intergenic
969976792 4:11110977-11110999 CACATGTCAAGGATGGGGCTAGG + Intergenic
970599803 4:17632773-17632795 AAATTGTAAAGGATGGGGCTGGG + Exonic
971919496 4:32918569-32918591 CACTTTTAATGGCTGGGTCTGGG - Intergenic
972132211 4:35851964-35851986 CACTTTGAGAGGCTGAGGCGGGG + Intergenic
972354495 4:38267653-38267675 CACCTTGAAAGGAAGGAGCTAGG + Intergenic
972444092 4:39127088-39127110 CACTTTGGGAGGCTGAGGCTGGG + Intergenic
973255949 4:48113728-48113750 CACTATGAAATGGTGGAGCTGGG - Intronic
973903925 4:55507365-55507387 CACTTTGGAAGGCTGAGGTTGGG + Intronic
973964261 4:56145031-56145053 CACTTTGGGAGGCTGGGGCGGGG - Intergenic
974802503 4:66836355-66836377 CAGTTTTAAAGGAAAGGGCTTGG + Intergenic
975573785 4:75843252-75843274 CAATTTGAAGGGATGGAGCTGGG + Intergenic
975655047 4:76633123-76633145 CACTTTGGAAGGCTGAGGCGGGG + Intronic
975932279 4:79539154-79539176 CACTTTGGAAGGCGGGGGCGGGG - Intergenic
976079087 4:81334771-81334793 CACTTTGACTGGCTGGGACTAGG - Intergenic
976301120 4:83516489-83516511 TACTTTGAAAGGCTGGGGCAAGG - Intronic
977446241 4:97136909-97136931 CACTTTGGGAGGCTGAGGCTGGG - Intergenic
977628246 4:99212634-99212656 CATTTTAAAAGGCTGGGGGTGGG - Intronic
978466987 4:109018517-109018539 CCCATTGAGAGGATGGGGCCAGG - Intronic
980513143 4:133820283-133820305 CCCTTTGAGAGGCTGAGGCTGGG + Intergenic
981185897 4:141802852-141802874 CACTTTGAGAGGCTGAGGCAGGG + Intergenic
981861898 4:149365492-149365514 CACACTCAAAGGATGGGGGTAGG - Intergenic
982115411 4:152094837-152094859 CTCTTTGAAGGAAAGGGGCTGGG - Intergenic
982115847 4:152097839-152097861 CACTTTGTGATGCTGGGGCTGGG - Intergenic
982731526 4:158960571-158960593 CTCTTTGAAAGGAGGGTGCTGGG + Intronic
982956661 4:161777846-161777868 CACTTTGGAAGGCTGAGGCAGGG + Intronic
983233441 4:165152447-165152469 CACTTTGGGAGGCTGGGGCGGGG - Intronic
983482938 4:168297674-168297696 CACTTTGGGAGGCTGGGGCCAGG + Intronic
983872499 4:172838248-172838270 AATCTTGAAAGGATGGGGCATGG + Intronic
984021509 4:174489241-174489263 CACTTTGAAAACATGGATCTAGG + Intergenic
987037383 5:14031991-14032013 CACTGTGAATGGAGGGGGCACGG - Intergenic
987575472 5:19722983-19723005 CACTTTGGGAGGCTGAGGCTAGG + Intronic
988222861 5:28371364-28371386 CACTTTGAGAGGCCGGGGGTTGG - Intergenic
988554075 5:32221411-32221433 CACTGTGAAATGATGGGGAACGG - Intergenic
989036509 5:37178368-37178390 CACTTTGAGAGGTTGAGGCTAGG + Intronic
989396019 5:40957699-40957721 CACTTTGAGAGGCTGCGGCAGGG - Intronic
990205833 5:53428475-53428497 CACTGAGAAGGCATGGGGCTGGG - Intergenic
991028883 5:62061708-62061730 CACTTAGAAAGGTTGGGGTCAGG + Intergenic
991275596 5:64842845-64842867 CACTTTGAGAGGGTGAGGGTGGG - Intronic
991366601 5:65874984-65875006 AATTTTAAAAGGCTGGGGCTAGG + Intergenic
991376547 5:65973987-65974009 CACTTTGGGAGGCTGAGGCTGGG + Intronic
991715195 5:69445161-69445183 CACTTTGGAAGGCTGAGGCAGGG - Intergenic
992119711 5:73579558-73579580 GACTTTGAATTGATGGGACTAGG + Intronic
992632482 5:78695474-78695496 GACTTTGGAAGGCTGAGGCTTGG - Intronic
994786562 5:104172744-104172766 CACTTTGGGAGGCTGAGGCTGGG + Intergenic
994903447 5:105804903-105804925 CACTTTGAGAGGCTGAGGCAGGG - Intergenic
994958682 5:106568504-106568526 TATTGTGAAAGGATGGGGTTGGG + Intergenic
995787278 5:115842557-115842579 CACCTGGAAAGGATGGGAGTCGG - Intronic
996037369 5:118772965-118772987 CACTTTGGGAGGTCGGGGCTGGG - Intergenic
996325369 5:122267264-122267286 AACTGTGAAAGGAAAGGGCTTGG - Intergenic
996428997 5:123349747-123349769 CACTTTGAGAGGATGGTGGGAGG - Intronic
997656329 5:135557566-135557588 CACTGGGAATGGAGGGGGCTGGG - Intergenic
998084296 5:139304261-139304283 CACTTTGAGAGGACGAGGCAGGG + Intronic
998240241 5:140435622-140435644 CACTTTGGAAGGCTGAGGCAGGG - Intronic
998454930 5:142264640-142264662 CACTTTGGGAGGCTGAGGCTGGG - Intergenic
998817855 5:146031873-146031895 CACATGGAAGGGATGGTGCTGGG - Intronic
999148286 5:149410127-149410149 CACTTTGGGAGGCTGAGGCTGGG - Intergenic
999199392 5:149805148-149805170 GACTTTGAAAGAATGGGGAGGGG - Intronic
999457641 5:151731002-151731024 AACTTTAAAAGGAAGGGGTTAGG - Intergenic
999753625 5:154648299-154648321 CACTTTGGGAGGCTGAGGCTGGG - Intergenic
1000313707 5:160069039-160069061 CACTTTGGGAGGCTGAGGCTGGG + Intronic
1000435971 5:161209182-161209204 CACTTTGGAAAGACTGGGCTGGG - Intergenic
1001270600 5:170308520-170308542 CACTTTGAAAGCATTTAGCTGGG + Intergenic
1001723369 5:173875310-173875332 GGCTCTGAAAGGGTGGGGCTGGG - Intergenic
1002436203 5:179233433-179233455 CACTTTGAAAGGCTGAGGGTGGG + Intronic
1002507949 5:179693292-179693314 CACTTTGGAAGGCTGAGGCAGGG + Intronic
1002625881 5:180528912-180528934 CACTTTTAAAAGATGTGGGTCGG + Intronic
1002915480 6:1524935-1524957 CACTCTGGGAGGCTGGGGCTGGG + Intergenic
1004433055 6:15563810-15563832 CACTTTGAGAGGCTGAGGCTGGG + Intronic
1005037930 6:21574123-21574145 CACTTTGGAAGGCTGAGGGTGGG - Intergenic
1005889557 6:30125894-30125916 CACTTTGGGAGGCTGAGGCTGGG - Intergenic
1006774485 6:36581418-36581440 CACTTTGAAAGGCTGAGGCAGGG + Intergenic
1007473948 6:42107000-42107022 CACTTTGAAAGAACGGGGGAAGG + Exonic
1007923527 6:45632019-45632041 CACTTTGAGAGGCTGAGGCAGGG - Intronic
1008352975 6:50515369-50515391 CACTTTGGAAGGCTGAGGCAGGG - Intergenic
1008412468 6:51196093-51196115 CAGCTGGAAAGGAAGGGGCTGGG - Intergenic
1012418328 6:99034341-99034363 CAGTTTGCAAAGATGTGGCTCGG - Intergenic
1012931044 6:105317201-105317223 CACTTTGAGAGGCTGGTGCAGGG - Intronic
1013245184 6:108279596-108279618 CACTTTGGGAGGATGAGGCAGGG - Intergenic
1013535277 6:111058133-111058155 CACTTTGGAAGGCTGAGGCGGGG - Intergenic
1013646944 6:112153489-112153511 AACTTTGAAGGGATGTGGGTAGG + Intronic
1014103570 6:117538376-117538398 CACTTATAAAGGATGTGACTTGG + Intronic
1014489614 6:122045801-122045823 CACTTTGAGAGGCTGAGGCAGGG + Intergenic
1015230161 6:130905663-130905685 CACTTTGAGAGGCTGAGGCCGGG - Intronic
1015817834 6:137228903-137228925 AGCTATGAAATGATGGGGCTGGG - Intergenic
1016458906 6:144261675-144261697 CACTTTGGGAGGCTGAGGCTAGG + Intergenic
1016737972 6:147500988-147501010 CACTTTGAGAAGCTGGGGCCAGG + Intergenic
1017831832 6:158137628-158137650 CACTTTGGAAGGCTGAGGCAGGG + Intronic
1018625342 6:165772402-165772424 CACTAGGAAACAATGGGGCTTGG - Intronic
1019993080 7:4705782-4705804 CACTTTGAGAGGCTGAGGCGGGG - Intronic
1021693151 7:23249165-23249187 CACTTTGGAAGGCTGAGGGTGGG - Intronic
1021937282 7:25643781-25643803 CAGTTGGAAAGGGTGGAGCTAGG - Intergenic
1022842912 7:34181864-34181886 CAATTTCAAAGGAGGGGGCATGG + Intergenic
1023434548 7:40128668-40128690 CACTTTGGGAGGCTGAGGCTGGG + Exonic
1025089444 7:56050509-56050531 CACTTTGGGAGGATGAGGCGGGG - Intronic
1025170408 7:56751515-56751537 CACTTTGGGAGGCTGAGGCTAGG + Intergenic
1025701479 7:63824191-63824213 CACTTTGGGAGGCTGAGGCTAGG - Intergenic
1025846333 7:65201679-65201701 CACATTGGAAGGATGGGACCAGG + Intergenic
1025908737 7:65810476-65810498 CACTTTGGGAGGAGGGGGCCAGG + Intergenic
1027059145 7:75071726-75071748 CAGTTGGTAAGGATGGGGCCAGG - Intronic
1027174867 7:75896892-75896914 CATTTTCAAAGGATGGGACCAGG + Intergenic
1028625407 7:92871590-92871612 CACTTTGGGAGGCTGAGGCTGGG + Intergenic
1030037590 7:105421211-105421233 CACTTTGGGAGGCTGAGGCTGGG + Intergenic
1030153487 7:106428509-106428531 CCCTTTGAAAGGAGAGAGCTAGG - Intergenic
1030600747 7:111589023-111589045 GACTTTGGAAGGATGGGGGTGGG + Intergenic
1032939206 7:136768794-136768816 CACCTTGAAGGGAAGGGCCTTGG + Intergenic
1033170909 7:139083481-139083503 CACTTTGAAAGGCTGAGGCAGGG + Intronic
1033439276 7:141364363-141364385 CACATTAAAAAGTTGGGGCTGGG + Intronic
1033800731 7:144898974-144898996 CACTTTGAAAGGTGGAGGCAAGG + Intergenic
1034454461 7:151159311-151159333 CACTTTGGGAGGCTGAGGCTAGG - Intronic
1036622717 8:10435837-10435859 CACTTTGGGAGGCTGGGGCAGGG + Intergenic
1036821100 8:11940796-11940818 CACTTTGGGAGGCTGAGGCTAGG + Intergenic
1037249009 8:16871100-16871122 CACATAGAAAGGATGAGGCTAGG + Intergenic
1037847869 8:22300179-22300201 CACTTTGGGAGGCTGAGGCTAGG - Intronic
1038012304 8:23484865-23484887 CACTTTGGAAGGCCGAGGCTGGG - Intergenic
1038402868 8:27298684-27298706 CACTTGGCATGGATGGGGTTAGG - Intronic
1038484076 8:27921424-27921446 GACTTAGAGAGTATGGGGCTGGG + Intronic
1038744390 8:30244508-30244530 CACTTTGGAAGGATGAGGCAGGG + Intergenic
1039128851 8:34237157-34237179 CACATTCAAAAGATGGTGCTGGG - Intergenic
1039942963 8:42107142-42107164 CACTTTGGGAGGATGGTGGTGGG - Intergenic
1040034221 8:42852886-42852908 CACTTTGGAAGGCTGAGCCTGGG + Intronic
1040363357 8:46688885-46688907 AACTTTGGAAGGCTGAGGCTAGG - Intergenic
1040592670 8:48808905-48808927 CACTTTGAGAGGCTGAGGCAGGG + Intergenic
1040830578 8:51672225-51672247 CACTTTGGGAGGCTGAGGCTAGG - Intronic
1041918167 8:63156815-63156837 CACTTTGAGAGGCTGAGGCAGGG - Intergenic
1042905120 8:73764742-73764764 CACTTTGGCAGGCTGGGGTTGGG + Intronic
1042931022 8:74014185-74014207 CACTTTGGGAGGCTGAGGCTAGG + Intronic
1043523034 8:81066863-81066885 CAGTTTAAAAGTATGAGGCTGGG + Intronic
1044961951 8:97539878-97539900 CAGTTTGCCAGGATTGGGCTGGG - Intergenic
1044987253 8:97766466-97766488 CACTTTGGAAGGCCGGGGCAGGG - Intergenic
1045414109 8:101949634-101949656 CCATTGGAAATGATGGGGCTGGG - Intronic
1045553184 8:103190948-103190970 CACTTTGGAAGGCTGAGGCGGGG + Intronic
1045863991 8:106844311-106844333 CACGTGTAAAGGATGGGGCCAGG + Intergenic
1047613770 8:126545877-126545899 CACTTTGAGAGGCTGAGGCAGGG + Intergenic
1049057869 8:140253429-140253451 CACTTTGAAAGGCTGAGGCAGGG + Intronic
1049843708 8:144789736-144789758 CCCTTTGAAACCATGGGGGTGGG + Intergenic
1050009268 9:1169632-1169654 CACTGAGAAAGGAGGGTGCTGGG + Intergenic
1050151010 9:2619642-2619664 CACTTTGATATAATGTGGCTTGG + Intergenic
1050328168 9:4517777-4517799 CACTTTCATGTGATGGGGCTTGG + Intronic
1052526735 9:29628497-29628519 CACTTTTCAATGATGGGGCCAGG + Intergenic
1052769946 9:32678422-32678444 CCCTTTGAAATGCAGGGGCTTGG + Intergenic
1053291669 9:36883434-36883456 CACTTTGAAAGGCTGAGGTCAGG + Intronic
1054951513 9:70857219-70857241 CAATTTGGTAGGATGTGGCTTGG + Intronic
1055967173 9:81876835-81876857 CACTTTGAGAGGACGAGGCGGGG + Intergenic
1056250190 9:84739765-84739787 CAGATGGAAAGGATGTGGCTGGG + Intronic
1056418501 9:86400948-86400970 CACTTTGAGAGGCTGAGGCAGGG - Intergenic
1056664875 9:88573387-88573409 CACTTTGGAAGGCTGAGGCAGGG - Intronic
1056934433 9:90904988-90905010 CAGGTTGAATGGATTGGGCTGGG - Intergenic
1057253278 9:93521369-93521391 CACTTTGAGAGGCTGAGGCAGGG + Intronic
1057729747 9:97598080-97598102 CACTTTGAGAGGCTGAGGCGTGG + Intronic
1057934965 9:99229570-99229592 CACTTTGAGAGGCTGAGGCCAGG - Intronic
1057987517 9:99732233-99732255 CACTTGGGAAGGCTGGGACTTGG + Intergenic
1058483728 9:105422579-105422601 CGCTGATAAAGGATGGGGCTGGG - Intronic
1059577820 9:115509892-115509914 CACTTTGGAAGGCTGAGGGTGGG - Intergenic
1060308617 9:122439025-122439047 CACTTTGAGAGGCTGAGGGTGGG - Intergenic
1060382169 9:123186094-123186116 CACTTTGGAAGGCTGAGGCCAGG + Intronic
1060639774 9:125228716-125228738 CACTTTGGGAGGCTGAGGCTGGG + Intronic
1061051223 9:128196845-128196867 CACTTTGAGAGGCTGAGGCGGGG - Intronic
1061381721 9:130262811-130262833 CACTCGGAGAGGATGGTGCTTGG + Intergenic
1061404841 9:130387828-130387850 CACTTTGAAAGGCTGAGGCAGGG + Intronic
1061944981 9:133903527-133903549 CACTTAGAAAATATGGGGGTGGG + Intronic
1062531664 9:137003963-137003985 CACTTTGAGAGGCCGAGGCTAGG + Intergenic
1062531866 9:137005238-137005260 CACTTTGGAAGGCTGAGGCTGGG + Intergenic
1062737711 9:138147520-138147542 CACTTTGAGAGGCTGAGGCGGGG - Intergenic
1203441140 Un_GL000219v1:9649-9671 CACTTTGAAAGGTGGAGGATGGG + Intergenic
1203511949 Un_KI270741v1:128557-128579 CACTTTGAAAGGTGGAGGATGGG + Intergenic
1185678405 X:1867597-1867619 CAATATGAAAATATGGGGCTGGG + Intergenic
1185807152 X:3068668-3068690 CACTTTGAGAGGCTGAGGCGGGG - Intronic
1186765739 X:12769039-12769061 CACTTTGAAGGGATAGGAGTTGG + Intergenic
1187906169 X:24068689-24068711 CACTTTGAAAGGCCGAGGCAGGG - Intronic
1188417147 X:29949671-29949693 TATTTTTAAAGGATAGGGCTAGG - Intronic
1189314906 X:40048309-40048331 CACTTTGGGAGGCTGAGGCTGGG + Intergenic
1190339388 X:49284929-49284951 CCCTTTCAAAAGATGGAGCTAGG + Intronic
1190721709 X:53154236-53154258 CACGTGTAAAGGATGGGGCTAGG - Intergenic
1190801594 X:53794489-53794511 CACTCTGGAAGCAGGGGGCTAGG + Intergenic
1191012546 X:55775547-55775569 CATTCTGATAGGATGGGGCATGG + Intergenic
1191851523 X:65589214-65589236 CACTTTGAAAACTTGGGACTGGG - Intronic
1193569391 X:83124007-83124029 CACTTTGAGAGGCTGAGGCGGGG + Intergenic
1194588320 X:95765435-95765457 CACCTTGCTTGGATGGGGCTTGG - Intergenic
1197014470 X:121607026-121607048 CACTTTGGAAGGCTGAGGCAGGG - Intergenic
1198252789 X:134897331-134897353 CACTTTGGGAGGTTGGGGCCTGG + Intronic
1198755650 X:139979428-139979450 CACTTTGGGAGGCTGGGGGTGGG + Intergenic
1199850715 X:151723368-151723390 AACTTTGCAAAGCTGGGGCTGGG - Intergenic
1200386533 X:155896694-155896716 CACTTTGAAAGCAGGGGGAGGGG - Intronic
1202581629 Y:26387794-26387816 CACTTTGAGAGGCTGAGGCAGGG - Intergenic