ID: 1092968279

View in Genome Browser
Species Human (GRCh38)
Location 12:13666727-13666749
Sequence GTGGAGATACAGCCTGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 220}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092968277_1092968279 -1 Left 1092968277 12:13666705-13666727 CCAGCTCTCATAAATAGGTATTG 0: 1
1: 0
2: 0
3: 6
4: 107
Right 1092968279 12:13666727-13666749 GTGGAGATACAGCCTGTGCATGG 0: 1
1: 0
2: 1
3: 22
4: 220
1092968275_1092968279 10 Left 1092968275 12:13666694-13666716 CCTGTTTCTGGCCAGCTCTCATA 0: 1
1: 0
2: 0
3: 17
4: 135
Right 1092968279 12:13666727-13666749 GTGGAGATACAGCCTGTGCATGG 0: 1
1: 0
2: 1
3: 22
4: 220
1092968274_1092968279 11 Left 1092968274 12:13666693-13666715 CCCTGTTTCTGGCCAGCTCTCAT 0: 1
1: 0
2: 0
3: 31
4: 230
Right 1092968279 12:13666727-13666749 GTGGAGATACAGCCTGTGCATGG 0: 1
1: 0
2: 1
3: 22
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092968279 Original CRISPR GTGGAGATACAGCCTGTGCA TGG Intronic
901052408 1:6431989-6432011 GAGGAGGTACAGCCTGCTCAAGG - Intronic
902481829 1:16716030-16716052 GAGGAGGTACAGCCTGCTCAAGG + Intergenic
904951207 1:34240455-34240477 GTGGAGATCTAACCTGTGTAGGG + Intergenic
905909733 1:41645564-41645586 GTGGTGATACATACTATGCAGGG - Intronic
907229426 1:52982135-52982157 CTTGTGATACAGCTTGTGCATGG + Intronic
907418915 1:54333351-54333373 GCAGAGCTACAGCCTGAGCATGG - Intronic
908334797 1:63110887-63110909 CTTGAGAAACAGCCTGTCCAAGG + Intergenic
912821336 1:112870266-112870288 ATGGACAAACAGCATGTGCAGGG - Intergenic
913974774 1:143446491-143446513 ATGGAGACCCAGCCTGTGCTGGG - Intergenic
914069165 1:144272107-144272129 ATGGAGACCCAGCCTGTGCTGGG - Intergenic
914109990 1:144694247-144694269 ATGGAGACCCAGCCTGTGCTGGG + Intergenic
915153508 1:153854970-153854992 GTGGTGATACAGACTGTTCTAGG + Intronic
915962520 1:160279073-160279095 GGGGAGAAACAGCCTGGGCTGGG - Exonic
916793476 1:168144918-168144940 GTGGAGAGAAAGCCTGCTCAGGG - Intergenic
917487826 1:175470759-175470781 ATGGAGATGCATCCTGTTCAAGG - Intronic
917911929 1:179657240-179657262 GGGGAGATACACCATGTTCATGG - Intronic
920916725 1:210263679-210263701 GTGGAGAAAGAGCCTTGGCAGGG + Intergenic
921676722 1:217984275-217984297 GTCAAGAGAGAGCCTGTGCAGGG + Intergenic
1064756995 10:18580468-18580490 CTGGAATTATAGCCTGTGCAAGG - Intronic
1068638181 10:59370739-59370761 GTGGAGAGACAGGCCCTGCAGGG - Intergenic
1071512097 10:86268430-86268452 ATGGACATGCAGCCTGAGCAAGG + Intronic
1071908031 10:90196765-90196787 ATGAAGATGCAGCCTGTGCTTGG + Intergenic
1074078239 10:110148862-110148884 GTGGAGATACGGCTTGTCCGAGG + Intergenic
1075196007 10:120359609-120359631 GTGGAGATACAGCCCTGGCAGGG - Intergenic
1075398731 10:122146245-122146267 GGGGAGAAACAGCATGTGCATGG + Intronic
1075681427 10:124335607-124335629 GTGGAGATACAGGGAGAGCATGG + Intergenic
1076100527 10:127774155-127774177 GTCCAGAGACAGGCTGTGCAGGG - Intergenic
1076194690 10:128508867-128508889 GCAGAGAGACAGCTTGTGCAGGG - Intergenic
1076827283 10:132975382-132975404 GAGGAGACACAGCCTGCGCCGGG - Intergenic
1079150040 11:17890182-17890204 GTGGGGAATCAACCTGTGCAAGG + Intronic
1080495798 11:32817531-32817553 GTGGAGACAGAGACTGTTCAAGG - Intergenic
1083325935 11:61873047-61873069 GTGGTGGTGCAGCCTGTGCCCGG - Intergenic
1084430686 11:69109276-69109298 GTGGAGATTTAGCCTGGGCCAGG + Intergenic
1084770449 11:71339689-71339711 TTGGAGGTAGAGCCTGTGCTGGG - Intergenic
1086173102 11:83858986-83859008 GCAAAGAGACAGCCTGTGCAGGG - Intronic
1086455081 11:86953333-86953355 TTGGAGAAACAGCTTTTGCAGGG - Intronic
1086957761 11:92951222-92951244 ATGGAGAGACAGGCTGGGCATGG + Intergenic
1087996818 11:104819245-104819267 GATGAAATACAGCCTGAGCAGGG + Intergenic
1090568205 11:128018959-128018981 TTGGAGAAAGAGCCTGAGCATGG - Intergenic
1091356874 11:134944178-134944200 GTGGAAATAGTGCCTGTGCCAGG + Intergenic
1092968279 12:13666727-13666749 GTGGAGATACAGCCTGTGCATGG + Intronic
1094495217 12:30985034-30985056 TTGGAGATACTTCCAGTGCAGGG + Intronic
1096707346 12:53430521-53430543 GAGGAGAGACAGGCTGGGCAAGG - Intronic
1096813005 12:54183566-54183588 GTGGAGAAGGAGCATGTGCATGG - Intronic
1097733898 12:63159925-63159947 GTGGATATATAGGCTGGGCACGG - Intergenic
1098994065 12:77097817-77097839 GGCGAGAGACAGCATGTGCAGGG + Intergenic
1099834868 12:87896392-87896414 AGAGAGATACAGCTTGTGCAGGG - Intergenic
1099880229 12:88459032-88459054 GTGGAGGGACAACCTGTGCAAGG + Intergenic
1100125716 12:91422278-91422300 GTGCACATTAAGCCTGTGCATGG - Intergenic
1101017515 12:100517534-100517556 GTGGAGATATACCCTGTGGTGGG + Intronic
1101446161 12:104738211-104738233 TTGGGCATAAAGCCTGTGCAGGG + Intronic
1102536727 12:113587157-113587179 GTGGAGACGCAGCATATGCACGG + Intergenic
1102943082 12:116961287-116961309 GTGCAGATACAGGCCGGGCACGG - Intronic
1103561869 12:121797168-121797190 GTGGAGACACAGCCTCTGCCTGG - Intronic
1103950150 12:124546019-124546041 GAGCAGAAACAGCCTGTGCCTGG - Intronic
1105026282 12:132851405-132851427 ATGGAGATGTAGCCTGTGAAGGG + Intronic
1105740679 13:23319829-23319851 GTGGAAATACAGCCTTTTCCAGG + Intronic
1106762176 13:32878098-32878120 GTGGAGACAGAGGCTATGCATGG + Intergenic
1107051709 13:36057636-36057658 TTGTAGTTTCAGCCTGTGCAGGG + Intronic
1107624345 13:42267705-42267727 CTGAAGAAACAGCCTGTGGAAGG + Intergenic
1109459283 13:62633857-62633879 GTGGAGGTACACCATGTTCATGG + Intergenic
1110568275 13:76977920-76977942 ATGCAGATACAGGCTGGGCATGG + Intergenic
1111551165 13:89814926-89814948 GGGGAGATAGAGCCATTGCAAGG - Intergenic
1115870305 14:37793416-37793438 GTGGACATACAGTGTGAGCAAGG - Intronic
1118517981 14:66547640-66547662 GTGGTGATATATCCTGTACAAGG + Intronic
1121158245 14:91707895-91707917 GTGGAAATACAGGCTGGGCATGG - Intronic
1121745109 14:96282680-96282702 TTGGACAAACAGCCTCTGCAGGG + Exonic
1121852029 14:97230117-97230139 GTGGAGACACAGCATCTGGAAGG - Intergenic
1122787138 14:104168986-104169008 GTGGAGAAACAGCCCGTGCCGGG - Intronic
1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG + Exonic
1123190656 14:106566152-106566174 TTGCAGATACAACCTGTGCTTGG + Intergenic
1123506295 15:20942995-20943017 GTGGAGGAACAGCCAGGGCAAGG + Intergenic
1123563521 15:21516699-21516721 GTGGAGGAACAGCCAGGGCAAGG + Intergenic
1123599773 15:21953986-21954008 GTGGAGGAACAGCCAGGGCAAGG + Intergenic
1124239443 15:28017695-28017717 CAGGTGACACAGCCTGTGCATGG + Intronic
1129271627 15:74422136-74422158 GGGAAGATGCAGCCTGTCCAAGG + Intronic
1129328257 15:74813219-74813241 GAGGAGAAACAGCTTGGGCAGGG - Intronic
1202971879 15_KI270727v1_random:243836-243858 GTGGAGGAACAGCCAGGGCAAGG + Intergenic
1132652339 16:1027209-1027231 CTGGAGATGCTGCCTGGGCAGGG + Intergenic
1134242928 16:12518955-12518977 CTGGTCATACTGCCTGTGCAAGG + Intronic
1136022876 16:27451089-27451111 GTGGAAACACAGCTTCTGCACGG + Exonic
1136363315 16:29795978-29796000 ATGGAGGTACAGGCTGGGCAGGG + Intronic
1137357740 16:47782809-47782831 CAGGAGATACAGCCTGTGAGAGG - Intergenic
1138116537 16:54365090-54365112 GCAGCAATACAGCCTGTGCAAGG - Intergenic
1139320005 16:66106707-66106729 GTGCTGATACAGCTTCTGCAGGG - Intergenic
1140826671 16:78713496-78713518 TTGGAGATACAGCCTTTTAAAGG + Intronic
1141000506 16:80303044-80303066 GGTGAGAGACAGCTTGTGCAGGG - Intergenic
1141669656 16:85485180-85485202 GTGGAGCGACAGCCTGTGCCCGG + Intergenic
1142687040 17:1583339-1583361 GTGGAGACACAGAACGTGCAGGG + Intronic
1143768821 17:9154895-9154917 GTGGACAGAGAGCCTTTGCAAGG - Intronic
1144730148 17:17521352-17521374 CTGGGGATGCAGGCTGTGCAGGG - Intronic
1145302766 17:21652787-21652809 GTGAGGATACAGGCTGTGGATGG - Intergenic
1145347536 17:22050402-22050424 GTGAGGATACAGGCTGTGGATGG + Intergenic
1146402414 17:32510356-32510378 GTGGTGAAAGTGCCTGTGCAGGG - Intronic
1151981448 17:77512376-77512398 GGGGCAATACAGCCTGTGCTGGG - Intergenic
1152673691 17:81625219-81625241 GTGGAGGTAACACCTGTGCAGGG + Intronic
1154107433 18:11534501-11534523 GTGGAGGAACAGCCAGGGCAAGG + Intergenic
1154170209 18:12046105-12046127 GTGGAGGAACAGCCAGGGCAAGG - Intergenic
1154485445 18:14868282-14868304 GTGGAGGTGCAGCCAGGGCAAGG + Intergenic
1155642088 18:28030607-28030629 GTGGAAGTTCAGCCTTTGCAGGG + Intronic
1161520918 19:4723246-4723268 GTGCATATACAGCATTTGCATGG + Intronic
1161522188 19:4730856-4730878 GTGGGGAGACAGCCTGTGGGGGG - Intergenic
1162838964 19:13341598-13341620 AGGGAGGGACAGCCTGTGCAAGG - Intronic
1162877002 19:13627846-13627868 GTGGAGATGAAGCTTGGGCAGGG - Intergenic
1163507821 19:17718698-17718720 CTCTAGATCCAGCCTGTGCAAGG - Intergenic
1163752001 19:19083712-19083734 GCAGAGGTACAGCCTGGGCAAGG + Intronic
1164578731 19:29421264-29421286 GTGCAGACACGGCCTGGGCAGGG + Intergenic
1165120696 19:33556650-33556672 GTGGAGATTCAGCGTGTGTGGGG - Intergenic
1165148599 19:33748344-33748366 GTGGAGACACAGCTTCTGCCAGG + Intronic
1167035371 19:46992256-46992278 GAGGTGATACAGCCTGCCCAGGG + Intronic
1168414952 19:56161768-56161790 GGGCAGGTACAGCCTGTGCCGGG + Intergenic
926286641 2:11494011-11494033 GTGGTGAAGCAGCCTGTGTAAGG - Intergenic
926343317 2:11922780-11922802 GTGCAGACACAGCCCCTGCATGG - Intergenic
927503170 2:23595792-23595814 GTGGAGAGACAGCATGGGAAGGG - Intronic
928612944 2:33008880-33008902 GTGGGGACACAGCCAGTGCAAGG + Intronic
929936337 2:46297072-46297094 GGGGAGAGGCAGCCTGCGCAGGG - Intronic
930379967 2:50615274-50615296 GTGGAGACACTGCCTGTGTGAGG - Intronic
934179472 2:89607459-89607481 ATGGAGACCCAGCCTGTGCTGGG - Intergenic
934289764 2:91681727-91681749 ATGGAGACCCAGCCTGTGCTGGG - Intergenic
935381261 2:102453096-102453118 GGGGAGATGCAGTCTGTGCCAGG + Intergenic
937914137 2:127090626-127090648 GTGGGGGAACAGCCTGTGCTGGG + Intronic
939007438 2:136805757-136805779 GAGGAGCTACAGACTCTGCAAGG - Intronic
939374663 2:141348915-141348937 GTGAAGAGAGAGCTTGTGCAGGG - Intronic
940548069 2:155115509-155115531 CTTGAGACAGAGCCTGTGCAGGG - Intergenic
947534876 2:230934161-230934183 GTGGAGAAACAGCCAGTGCAGGG - Intronic
1168760311 20:346389-346411 CTGGAGAGCCAGCCTGTGCCAGG - Intergenic
1169445163 20:5665603-5665625 GTAGAGATAGAGCCTCTGAATGG - Intergenic
1171009123 20:21498383-21498405 GCGGAGAGGCTGCCTGTGCAGGG - Intergenic
1171534496 20:25874372-25874394 GTGGAAAGATAGGCTGTGCACGG - Intergenic
1171573380 20:26275334-26275356 GTGGAAAGATAGGCTGTGCACGG + Intergenic
1172798060 20:37556878-37556900 GAGGAGAAACAGCCTGTGTGAGG - Intergenic
1173685855 20:44922979-44923001 GTGTACATACAGCGTGTCCAGGG + Intronic
1175288574 20:57856478-57856500 ATGGAGGTAGAGCCTGTGCCAGG + Intergenic
1176795891 21:13371195-13371217 GTGGAGGTGCAGCCAGGGCAAGG - Intergenic
1178424558 21:32469014-32469036 GAGGAGAAAGAGCCTGTGCATGG - Intronic
1179129341 21:38620721-38620743 GTGGAGAGAAAGCCTGTCCTTGG - Intronic
1179537168 21:42060214-42060236 GAGGGGACACACCCTGTGCACGG + Intergenic
1180289573 22:10784433-10784455 GTGGAGGTGCAGCCAGGGCAAGG - Intergenic
1180305324 22:11068366-11068388 GTGGAGGTGCAGCCAGGGCAAGG + Intergenic
1180720172 22:17902106-17902128 GTGGAGACAGAGGCTGTGCACGG + Intronic
1181455245 22:23055861-23055883 GCTGAGATACGGCATGTGCATGG + Intergenic
1181634617 22:24168883-24168905 GTGGAGATGCAGCCTATACAGGG + Intronic
1182891091 22:33819480-33819502 TTGGTGAAACAGCCTGTGGATGG - Intronic
1183441733 22:37826892-37826914 GTAGAGCAACAGCCTGTGCAAGG + Intergenic
1183554285 22:38513129-38513151 CTGCAGAAACAGCCTGGGCATGG + Intergenic
1184515155 22:44957164-44957186 GTGGACCCACAGCCTCTGCAGGG + Intronic
1184933797 22:47703519-47703541 ATGGAGACTCAGGCTGTGCATGG - Intergenic
1185290422 22:50023274-50023296 GTTGAGATACATCATGTGCAGGG + Intronic
949679372 3:6495167-6495189 GAGGAAATCCAGCATGTGCAGGG + Intergenic
950467065 3:13161949-13161971 GTGGGGGAACAGCATGTGCAGGG - Intergenic
953967373 3:47319825-47319847 GTGCAGTTTCAGCCTGTGCACGG + Intronic
956379133 3:68647439-68647461 GGGAAGATAGAGCATGTGCAGGG - Intergenic
959697832 3:109268628-109268650 GTGGAGATACAGATTGTGGTAGG - Intergenic
961434702 3:126908943-126908965 GTGGTCAGACCGCCTGTGCAGGG - Intronic
962635674 3:137329104-137329126 GTGTAGACACAGCCTGTGTAGGG + Intergenic
963066858 3:141271103-141271125 GTTGAGATACCACCTGTGAATGG - Intronic
966464299 3:180212814-180212836 CTGGAGACACAGCCTGGGGATGG - Intergenic
971670374 4:29547638-29547660 GTAAAGAGAGAGCCTGTGCAGGG + Intergenic
972681194 4:41308580-41308602 GTGGTGAAGCAGTCTGTGCACGG - Intergenic
975329648 4:73099447-73099469 GTGGGGATGCAGCATGTGCAGGG - Intronic
975410104 4:74038960-74038982 CTGAAGATACAGCCTGTGAGGGG + Intergenic
976774109 4:88688382-88688404 GTGGAAATAGACCGTGTGCAGGG + Intronic
977146223 4:93443618-93443640 GTGGTGATACATCATGAGCAGGG + Intronic
981422458 4:144566882-144566904 GTGAAGTTAAAGCCTGTGCTTGG + Intergenic
984654306 4:182300618-182300640 GTGGAGACATAGCAAGTGCAAGG - Intronic
986493714 5:8320262-8320284 GTGCAGAGACATCCTCTGCAGGG + Intergenic
988683851 5:33509034-33509056 GGAGAGATCCAGCCTATGCATGG - Intergenic
990941593 5:61207621-61207643 GTAGAGAGAGAGCTTGTGCAGGG + Intergenic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
993557955 5:89365660-89365682 GTTGAGATACAATCTGTCCAAGG - Intergenic
993724115 5:91348871-91348893 GTGGAGAGAGAGCTTGTGCAGGG + Intergenic
995971982 5:117983713-117983735 TTGGAGATACAGCAGGGGCAGGG - Intergenic
996087810 5:119322188-119322210 GTGGAGATAAACGCTGTGGAGGG - Intronic
997707307 5:135968612-135968634 GAGAAGAGAGAGCCTGTGCAGGG - Intergenic
999115481 5:149159883-149159905 ATGGAGAAACAGCATTTGCAAGG - Intronic
999744746 5:154583741-154583763 GTGGAAGTAGAGGCTGTGCAGGG - Intergenic
1001081465 5:168670862-168670884 GGGCAGACTCAGCCTGTGCAAGG - Intronic
1001677575 5:173531327-173531349 GTGGAGAGACAGCATGTGCTTGG - Intergenic
1001980431 5:176034323-176034345 GTGGAGGTGCAGCCAGGGCAAGG - Intronic
1002237030 5:177809742-177809764 GTGGAGGTGCAGCCAGGGCAAGG + Intergenic
1002514820 5:179749855-179749877 GTGGAAATACAGTCAGAGCAAGG - Intronic
1002527864 5:179824949-179824971 GTGGAGATGCTCTCTGTGCAGGG + Intronic
1002584079 5:180230509-180230531 TTCGAGATACAGCCTGAGCAGGG - Intergenic
1004558888 6:16728336-16728358 GTGGAGATTCATGCTGGGCATGG + Intronic
1005434018 6:25788477-25788499 GAGGTGTTAGAGCCTGTGCAGGG + Intronic
1012099934 6:95020356-95020378 GGGGAGATACAGTGTGTTCATGG - Intergenic
1012413246 6:98984211-98984233 TTGGAGATAGGGCCTGTGGAAGG + Intergenic
1013148832 6:107424605-107424627 CTGAAGATACAGGCTGTGTAAGG + Intronic
1014157967 6:118134153-118134175 AAGGAGAAACTGCCTGTGCAGGG + Intronic
1015297009 6:131607200-131607222 GTGGGGTTACAGCTAGTGCATGG + Intronic
1015297013 6:131607222-131607244 GTGGGGTTACAGCTAGTGCATGG + Intronic
1015548019 6:134382231-134382253 GTGGAGATTCAGACTGTCCTTGG + Intergenic
1015716806 6:136201312-136201334 GTGGGGATAGGGCCTGTGCTTGG - Intergenic
1017427293 6:154335533-154335555 GTGAAGATACAACCTGTTGAAGG + Intronic
1018002235 6:159589505-159589527 GTGGAGATATAGCCTACTCAAGG - Intergenic
1018608086 6:165620285-165620307 GTGCAGATACTGCCTGGCCAGGG - Intronic
1018879697 6:167864791-167864813 GTGAAGAGACAGCTTGTCCAGGG + Intronic
1019690144 7:2405873-2405895 GAGAAGAGACAGCCTGTACAAGG + Intronic
1025805637 7:64830611-64830633 ATGAAGATACAGGCTGGGCATGG - Intronic
1026095670 7:67344610-67344632 CTGGAGATGCAGCATGAGCAAGG - Intergenic
1026362574 7:69616329-69616351 GTGGAGATAGATGCTGTACAAGG - Intronic
1026853274 7:73737833-73737855 CTGGGGATACACCCTGTGGAGGG + Intronic
1027216842 7:76189246-76189268 GTGTAAATACAGCCAGTGCATGG + Intergenic
1028954461 7:96673570-96673592 GTGAAGGTCCAGCCTGGGCAAGG - Intronic
1030217863 7:107064667-107064689 GTTGAGATTCAGCCTGTGAAGGG - Intronic
1031932419 7:127699372-127699394 GTAGATATACAGTCAGTGCAAGG + Intronic
1035781399 8:2230786-2230808 GGGGAGAGACAGCGTGTGGAAGG + Intergenic
1036098178 8:5748386-5748408 GAGGAGATACAGCAGGTGTACGG + Intergenic
1037419356 8:18685896-18685918 GTGGGGATAAAGACAGTGCACGG + Intronic
1039189793 8:34960359-34960381 ATGGCTATACAGACTGTGCAAGG + Intergenic
1041195836 8:55400585-55400607 GCAGAGAGACAGCCTGAGCAAGG + Intronic
1041367370 8:57122450-57122472 GTGTATATATAGCCTGTGCTTGG + Intergenic
1042903042 8:73747010-73747032 GTGGAGGTAGAGCCGGTGCCGGG - Intronic
1046646751 8:116793853-116793875 GTGGAGATGCAGCCTTGGCCAGG - Intronic
1048162477 8:132033797-132033819 CTGGAGATTTGGCCTGTGCATGG - Intronic
1049072321 8:140365623-140365645 GTGCAGTTGCAGCCTGTGCGGGG - Intronic
1049100447 8:140575137-140575159 TGGGAGATCCAGCCTGGGCAGGG + Intronic
1049271128 8:141696863-141696885 TAGGAGGCACAGCCTGTGCAGGG + Intergenic
1049683393 8:143929773-143929795 GTGCAGCTCCAGGCTGTGCAGGG + Exonic
1050606378 9:7305656-7305678 GTGGAGAGAGGGCCTGTGAATGG - Intergenic
1052736172 9:32344796-32344818 GTGGAGAGGCAGCCTGTGGGAGG - Intergenic
1053423658 9:37997200-37997222 ATGGAGATACAGCCTGTGGCCGG - Intronic
1053886364 9:42647157-42647179 GTGGAGGTGCAGCCAGAGCAAGG + Intergenic
1054225384 9:62454606-62454628 GTGGAGGTGCAGCCAGAGCAAGG + Intergenic
1058681860 9:107447058-107447080 GTGGAGAGACAGCCACTGAAAGG + Intergenic
1059180168 9:112204577-112204599 GTGGAAAAACACTCTGTGCATGG - Intergenic
1059352563 9:113676048-113676070 GTGGAGAAATAGGCTGGGCATGG + Intergenic
1059738915 9:117130424-117130446 GTAGAGAGAAAGCCTGAGCAAGG - Intronic
1060911157 9:127352191-127352213 GTGGAGCCCAAGCCTGTGCAAGG - Intronic
1061756103 9:132813567-132813589 GAGGAGCTGCAGCATGTGCAGGG + Intronic
1062044107 9:134417327-134417349 GGTGAGTTGCAGCCTGTGCAGGG + Exonic
1185735411 X:2492062-2492084 GTTGGGATACAGTCAGTGCAAGG + Intronic
1187433407 X:19245080-19245102 GAGGAGAGAGAGCTTGTGCAGGG - Intergenic
1189051140 X:37646935-37646957 ATGGAGATACAAGCTGTTCAAGG - Intronic
1189783785 X:44541845-44541867 GTAGACCTACTGCCTGTGCACGG + Intronic
1190335434 X:49258886-49258908 GAGCAAACACAGCCTGTGCAGGG - Intronic
1190834882 X:54091347-54091369 GGGTAGACACTGCCTGTGCAAGG + Exonic
1190930972 X:54949567-54949589 ATGGAGAGATAGACTGTGCATGG - Intronic
1191864878 X:65695920-65695942 GTAGAGAGACAGCATGTACAGGG - Intronic
1194108798 X:89804693-89804715 GTGGAGATACTGCTTCTGCTTGG + Intergenic
1197815622 X:130495019-130495041 GTGGAGGGCCATCCTGTGCACGG - Intergenic
1198050032 X:132942716-132942738 GTGTAGACACAGCCTTTGGAGGG - Intronic
1198151211 X:133912228-133912250 GTGGGATTACTGCCTGTGCAAGG + Intronic
1200931972 Y:8705127-8705149 GTGAAGATACAGTCTGTTGAGGG - Intergenic