ID: 1092972196

View in Genome Browser
Species Human (GRCh38)
Location 12:13706970-13706992
Sequence TTGGCTATAGAGAGGCAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 186}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092972189_1092972196 15 Left 1092972189 12:13706932-13706954 CCATCTATTATCCCTTGTAAAAA 0: 1
1: 0
2: 2
3: 19
4: 325
Right 1092972196 12:13706970-13706992 TTGGCTATAGAGAGGCAATGAGG 0: 1
1: 0
2: 0
3: 15
4: 186
1092972188_1092972196 16 Left 1092972188 12:13706931-13706953 CCCATCTATTATCCCTTGTAAAA 0: 1
1: 0
2: 0
3: 18
4: 201
Right 1092972196 12:13706970-13706992 TTGGCTATAGAGAGGCAATGAGG 0: 1
1: 0
2: 0
3: 15
4: 186
1092972187_1092972196 17 Left 1092972187 12:13706930-13706952 CCCCATCTATTATCCCTTGTAAA 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1092972196 12:13706970-13706992 TTGGCTATAGAGAGGCAATGAGG 0: 1
1: 0
2: 0
3: 15
4: 186
1092972186_1092972196 20 Left 1092972186 12:13706927-13706949 CCACCCCATCTATTATCCCTTGT 0: 1
1: 0
2: 0
3: 16
4: 162
Right 1092972196 12:13706970-13706992 TTGGCTATAGAGAGGCAATGAGG 0: 1
1: 0
2: 0
3: 15
4: 186
1092972190_1092972196 4 Left 1092972190 12:13706943-13706965 CCCTTGTAAAAATCTCTTTGCCC 0: 1
1: 0
2: 5
3: 23
4: 271
Right 1092972196 12:13706970-13706992 TTGGCTATAGAGAGGCAATGAGG 0: 1
1: 0
2: 0
3: 15
4: 186
1092972191_1092972196 3 Left 1092972191 12:13706944-13706966 CCTTGTAAAAATCTCTTTGCCCA 0: 1
1: 0
2: 5
3: 25
4: 240
Right 1092972196 12:13706970-13706992 TTGGCTATAGAGAGGCAATGAGG 0: 1
1: 0
2: 0
3: 15
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092972196 Original CRISPR TTGGCTATAGAGAGGCAATG AGG Intronic
902692973 1:18121792-18121814 TTGGACATTGAGAGCCAATGGGG - Intronic
904984514 1:34533912-34533934 AAGGCTTTAGAGAGGCAATAAGG - Intergenic
908428105 1:64028458-64028480 TGGGCTAAAGAGAGGAGATGTGG - Intronic
916881730 1:169025414-169025436 TTCACTACAGAGAGGCAATTGGG - Intergenic
917171658 1:172183109-172183131 ATGGCCATAGAGAGGGAAAGGGG + Intronic
921086242 1:211795947-211795969 TGGGCTATTAAGAGGTAATGTGG + Intronic
921229576 1:213055223-213055245 TTGCCTAGAGATAGGGAATGAGG - Intronic
921357600 1:214300504-214300526 TTTGCTTTAAAGATGCAATGGGG - Intronic
1065310598 10:24412715-24412737 ATGAATATAGAGAAGCAATGAGG - Intronic
1067220448 10:44340320-44340342 TTGGCTACAGAGACGCAGGGTGG + Intergenic
1067971264 10:50973530-50973552 TTGGCTATTGGGAGGCCAGGAGG + Intergenic
1070451035 10:76557380-76557402 TTTCCCAAAGAGAGGCAATGTGG - Intronic
1070561054 10:77566823-77566845 TCGGCTACAGAGAGACAATAAGG + Intronic
1073624586 10:105083851-105083873 TTGGAGAAAGGGAGGCAATGAGG + Intronic
1075817836 10:125279499-125279521 TAGGCTTTTGAGGGGCAATGGGG + Intergenic
1080058820 11:27935070-27935092 TGGGCTAGAGATAGGAAATGAGG + Intergenic
1081011720 11:37821302-37821324 TTTGCTATGGAGAGGAAATGAGG + Intergenic
1082888837 11:58116811-58116833 TTCCATATGGAGAGGCAATGAGG + Intronic
1083068319 11:59948778-59948800 TTTGATATTGAGAGGCAATTTGG + Intergenic
1092540207 12:9415998-9416020 TTGTATCTACAGAGGCAATGTGG - Intergenic
1092972196 12:13706970-13706992 TTGGCTATAGAGAGGCAATGAGG + Intronic
1094347049 12:29482184-29482206 GTGGCTGGAGAGGGGCAATGTGG - Intronic
1095618633 12:44222822-44222844 CTTGCTATAGAGATGTAATGGGG - Intronic
1096862843 12:54542400-54542422 TTGGCTGCAGGAAGGCAATGTGG - Intronic
1097972520 12:65649769-65649791 TTGGCATTAGGGAGCCAATGTGG + Intergenic
1098609934 12:72444101-72444123 TTGCCTATAAAGAAACAATGTGG - Intronic
1099498185 12:83378510-83378532 TGGGCTATGGAGAGTCCATGGGG - Intergenic
1100108321 12:91205758-91205780 TTGGATACAGAGAGACAGTGCGG + Intergenic
1101191568 12:102338913-102338935 TTGCCTTTAGAAAGGTAATGGGG - Intergenic
1108436077 13:50402888-50402910 GTCGCTATCCAGAGGCAATGAGG + Intronic
1112684983 13:101814552-101814574 TTGGCTACAAAGAGGCAAAAGGG - Intronic
1114416137 14:22545943-22545965 TTGGCTTTAAAGAGGAAAGGGGG - Intergenic
1202832013 14_GL000009v2_random:45147-45169 TGTGCTATAGAGAAGCATTGTGG + Intergenic
1125449496 15:39793619-39793641 TTGGCTATAGAGAAGATATGGGG + Intergenic
1126980052 15:54230815-54230837 TTTGATATAGGTAGGCAATGTGG - Intronic
1127290148 15:57562738-57562760 TTGACTATAGAGCCACAATGAGG - Intergenic
1127607495 15:60602917-60602939 TTGGCTATAAAGGGGCACAGAGG - Intronic
1128538095 15:68505585-68505607 TTGGTCAGAGAGAGGCAACGAGG + Intergenic
1129329865 15:74821565-74821587 ATGGCAATGGAGATGCAATGAGG - Intronic
1130910221 15:88265746-88265768 TTGTCCCTAGTGAGGCAATGAGG + Intergenic
1133821338 16:9239228-9239250 TTGGCAACATAGAGGCCATGTGG - Intergenic
1134368961 16:13605988-13606010 TTATTTTTAGAGAGGCAATGTGG - Intergenic
1135627905 16:24012148-24012170 TTGGCCATGGAGAGAAAATGAGG - Intronic
1137961260 16:52884379-52884401 TAGGCTATAGAAAGTCAATGAGG + Intergenic
1138219679 16:55240106-55240128 TGGCCTATAGAGAGGCAGTACGG + Intergenic
1138260907 16:55621403-55621425 TTGGCTATAGAGAGGAGGAGGGG - Intergenic
1139713038 16:68790983-68791005 TGGGGTATGGGGAGGCAATGAGG + Intronic
1141133234 16:81448869-81448891 TTGGGTACAAAGAGGGAATGGGG - Intronic
1142781056 17:2181672-2181694 TGGGCTACAGAGAGGCAGAGGGG - Intronic
1143385785 17:6529805-6529827 TTGGCTATAGGGGGGCCATGGGG - Intronic
1144625703 17:16843457-16843479 TTGGGTACAGAGAAGCAGTGTGG + Intergenic
1144880728 17:18429263-18429285 TTGGGTACAGAGAAGCAGTGTGG - Intergenic
1145151507 17:20515124-20515146 TTGGGTACAGAGAAGCAGTGTGG + Intergenic
1145859321 17:28194390-28194412 TTATCTATGGAGAGGCAATCTGG - Intronic
1146382793 17:32343550-32343572 TTTGATATGGAGAGGCAATTTGG - Intronic
1148999484 17:51742290-51742312 TTGGAGATTGAGAGGAAATGAGG - Intronic
1149316376 17:55442707-55442729 TTGGCTAAAGAGAGCCAATCCGG - Intergenic
1149516966 17:57288039-57288061 TTGGGAGAAGAGAGGCAATGTGG + Intronic
1150376805 17:64688188-64688210 TTGGCTATGTAGAGGATATGGGG + Intergenic
1150779002 17:68103585-68103607 TGGGCTATATAGAGAAAATGAGG + Intergenic
1152256384 17:79242524-79242546 TTGCCTTTAGAGAGGAAAGGAGG + Intronic
1153434389 18:5053621-5053643 TTGACCATAGTGAGGCACTGAGG - Intergenic
1153613076 18:6907679-6907701 GTGGCTATAAAGAGGCAACAGGG + Intronic
1155558517 18:27049322-27049344 TTGGGTATAGAGATGCAAGTTGG + Intronic
1156379513 18:36545005-36545027 TTGGCCATGAAGAGTCAATGAGG + Intronic
1156888001 18:42157954-42157976 CTGGCTAGAGAGAAGCAGTGGGG - Intergenic
1158433421 18:57414341-57414363 ATGGCTATAAAAAGTCAATGTGG + Intergenic
1161212423 19:3074331-3074353 GTGTCTATGGGGAGGCAATGGGG - Intergenic
1164453071 19:28383281-28383303 TTGGCTATAGTGAGTTAATCAGG - Intergenic
1164805199 19:31110919-31110941 CAGACTAGAGAGAGGCAATGGGG + Intergenic
1165059920 19:33200110-33200132 TGCGCTTTAGAGATGCAATGTGG + Intronic
1202640669 1_KI270706v1_random:82605-82627 TGTGCTATAGAGAAGCATTGTGG - Intergenic
925104985 2:1283340-1283362 TTGGCCAAAGGGAGGCAAAGGGG - Intronic
928277695 2:29917981-29918003 TTGGCTGTAGGGAAGCATTGTGG - Intronic
930245932 2:48983475-48983497 TTGTGTGTAGAGAAGCAATGCGG + Intronic
935238727 2:101159943-101159965 TTTGCAATAGAGATTCAATGTGG - Intronic
938403237 2:131011678-131011700 TGGGGTAGAGAGAGGAAATGAGG + Intronic
938983750 2:136552506-136552528 ATTTTTATAGAGAGGCAATGCGG + Intergenic
940986930 2:160060227-160060249 GTGGCTAAAGTGAGTCAATGTGG + Intronic
942186630 2:173430244-173430266 ATGGCTAAGGAGAGGCAGTGTGG - Intergenic
944757932 2:202783132-202783154 TTGTAAATAGAGAGGGAATGAGG + Intronic
945051671 2:205829890-205829912 TTGCCTATAAAAAGTCAATGTGG + Intergenic
945633660 2:212318915-212318937 ATGGCTACAGAGAGCCAGTGGGG + Intronic
1170297312 20:14842153-14842175 TTCTCTAGAGAGAGGAAATGTGG + Intronic
1171481927 20:25460837-25460859 TTGGCTACAGAGAGGAAAGGGGG - Intronic
1171887555 20:30669352-30669374 TGTGCTATAGAGAAGCATTGTGG - Intergenic
1172071756 20:32262537-32262559 TTGACTATATAAAGTCAATGTGG - Intergenic
1174411157 20:50337292-50337314 TTGGTTATACAAGGGCAATGAGG + Intergenic
1174902434 20:54514606-54514628 TTGGCTACAGAAAGGCAATCAGG + Intronic
1177115888 21:17086472-17086494 TTTGCTATAGAGAGACAATATGG - Intergenic
1177809285 21:25907878-25907900 CTAGCTTTATAGAGGCAATGAGG - Intronic
1182179349 22:28329422-28329444 GTGGTTATAGAGATGTAATGAGG - Intronic
1182426331 22:30274889-30274911 TGTGCTCTGGAGAGGCAATGGGG - Intergenic
1182978508 22:34646024-34646046 TTGGCTTTAGAGATGAAATTTGG + Intergenic
1183764147 22:39855008-39855030 TAGACTGTAGAGAGGCAATGGGG - Intronic
1185045839 22:48528370-48528392 TTGGCTATACACAGGCATCGGGG - Intronic
949181956 3:1142812-1142834 TAGCCTTTAGAAAGGCAATGGGG + Intronic
949238972 3:1846837-1846859 AAGGCTATAGAGAAGCAAAGGGG + Intergenic
949639359 3:6017685-6017707 TTGGCTATACATAGGAAAAGAGG + Intergenic
951892208 3:27577882-27577904 GTGGCTAGAGAGAGGTAATTGGG - Intergenic
952377506 3:32779998-32780020 AGGGCTATGGAGAGGCAGTGTGG - Intergenic
953348173 3:42193631-42193653 TGGGCTATAGAGAATGAATGTGG + Intronic
953564650 3:44021432-44021454 TTGGGTATAGGGAGGGAAGGAGG - Intergenic
955023649 3:55145816-55145838 TTGGCTCCAAAGAGACAATGAGG - Intergenic
955490791 3:59480072-59480094 CTGGGTATAGTGAGGCCATGTGG + Intergenic
955565755 3:60243434-60243456 CTGGCCATGGAGAGGCGATGGGG + Intronic
955629072 3:60952503-60952525 TTGGCCATTCAGAGGCAATGTGG - Intronic
955892584 3:63665818-63665840 TTGCCAAGAGAGAGGCAAAGAGG + Intronic
961492884 3:127267431-127267453 GTGACTAAAGAGAGGGAATGGGG + Intergenic
961737809 3:129013215-129013237 TTGGATATAGACAGTCAAAGTGG + Intronic
967459157 3:189725137-189725159 TTGACTAAAGACAGGAAATGTGG - Intronic
1202737882 3_GL000221v1_random:24782-24804 TGTGCTATAGAGAAGCATTGTGG + Intergenic
968890429 4:3365932-3365954 TTGGCTCTGGGGAGGCAGTGGGG + Intronic
970149014 4:13069423-13069445 TTGGCTTTACAGAGGCAAAAGGG - Intergenic
970203900 4:13636542-13636564 GTTGCTCTAGAGAGGCCATGGGG + Intergenic
970366342 4:15362277-15362299 TTGTCTATATAGAGGGAAAGAGG - Intronic
973384185 4:49493139-49493161 TGTGCTATAGAGAAGCATTGTGG - Intergenic
975831637 4:78375044-78375066 TTTGTTATAGAGAGGCTATACGG - Intronic
978770348 4:112449985-112450007 TTGTCTATAGTGGGGCAAAGGGG - Intergenic
978993734 4:115122723-115122745 TTGGGAATATAGAGGCAAAGAGG + Intergenic
979343660 4:119559147-119559169 TTTCCTACAGAGAGGGAATGTGG + Intronic
979425774 4:120563668-120563690 CTGGCAATACAGAGGCCATGTGG - Intergenic
982222468 4:153136771-153136793 TTGCTGATAGAGAGGCACTGGGG + Intergenic
982827341 4:160017839-160017861 TTGGCAATAGACAGTCACTGAGG + Intergenic
982837025 4:160131513-160131535 ATGGGTAGAGAGAGGCAAGGTGG - Intergenic
985081641 4:186271232-186271254 TTGGATAAAGAGACGCAATTAGG + Intronic
1202768040 4_GL000008v2_random:168460-168482 TGTGCTATAGAGAAGCATTGTGG - Intergenic
986078240 5:4360345-4360367 TTGGCTATCGAGATTTAATGTGG - Intergenic
988420341 5:30998356-30998378 TTGAATAAAGAGAGGCAATGTGG - Intergenic
988464269 5:31473400-31473422 TTGGCTGTAGAACAGCAATGTGG - Intronic
991032076 5:62092848-62092870 TTGACTATAGACAGGGAATTAGG + Intergenic
991422895 5:66459475-66459497 TTGTATAAAGAGAGGCAAAGAGG - Intergenic
994170735 5:96657302-96657324 TTTGCTATAGTGAAGAAATGTGG + Intronic
994225504 5:97247820-97247842 TTGGATAGAGAGAGGAAATAAGG + Intergenic
995037891 5:107556096-107556118 TGTGCCAAAGAGAGGCAATGGGG - Intronic
996041922 5:118824022-118824044 TGAGCTCTAGAGATGCAATGAGG + Intergenic
998222046 5:140291003-140291025 TTGTTTCTAAAGAGGCAATGAGG - Intronic
998875464 5:146594559-146594581 ATGGCTTTAGAGATGAAATGAGG - Intronic
1000677870 5:164144163-164144185 TTGGGTAGAGAGAGGCAAGTTGG - Intergenic
1000684068 5:164224973-164224995 TTGGCCAGTGAGAGGCACTGAGG - Intergenic
1001030753 5:168261051-168261073 GTAACTATAGAGAGGCAAGGAGG + Intronic
1001405189 5:171471453-171471475 ATGGATAGAGAGAGGCAAAGAGG - Intergenic
1001958501 5:175865024-175865046 TTGGATGAAGGGAGGCAATGAGG - Intronic
1002211815 5:177603981-177604003 TTGGGTCTAGAGAGGCAAGCAGG + Intronic
1002307510 5:178292509-178292531 GTGGCTTTAGAGGGGCAATGTGG + Intronic
1005783771 6:29220830-29220852 TTGACTATAGGGTGGCAATCGGG + Intergenic
1006455147 6:34127604-34127626 TTGGCTGTGGAGAGGCCATTTGG + Intronic
1008422121 6:51313461-51313483 TTGGTTATAGAGATTAAATGTGG - Intergenic
1008579229 6:52890684-52890706 ATGGCTGGAGAGAGGCAGTGGGG - Intronic
1010038039 6:71348384-71348406 TTGGGTAAAGATAGGCAATGAGG - Intergenic
1011165063 6:84437481-84437503 TTGGTTATAGAGAAGCACTGTGG + Intergenic
1011178253 6:84588311-84588333 TTGGCTACATAAAGGCACTGTGG - Intergenic
1013403660 6:109823247-109823269 TTGGTTATAGAGAGAGCATGAGG - Intronic
1013642397 6:112098626-112098648 GTGACTATAGAGAAGCAGTGGGG + Intronic
1014790119 6:125662996-125663018 TTAGCTCTTGAGAGGCAATTTGG + Intergenic
1014882814 6:126744418-126744440 TGGGCTATTGAGAGACAGTGTGG + Intergenic
1015274455 6:131369552-131369574 TGGGATACAGAGAGCCAATGAGG + Intergenic
1016613201 6:146016867-146016889 TTGGCTATATGGAGTCAGTGAGG + Intergenic
1017385781 6:153880980-153881002 TTGGCTCTGGAGAGGCAAATGGG + Intergenic
1019041700 6:169111199-169111221 ATCACTTTAGAGAGGCAATGTGG + Intergenic
1020684959 7:11283413-11283435 TTGGCTATAAAGAGGCCAAGAGG + Intergenic
1020915811 7:14191258-14191280 CTGGCTATAGAGTGGCTAAGTGG - Intronic
1021178406 7:17476974-17476996 TTGGTTCTAGAGAGACAATATGG + Intergenic
1026794316 7:73356619-73356641 TTGGTTATAGAGAAACAATTAGG - Intronic
1027004348 7:74679732-74679754 CTGGCTGTAAAGAGGCAATTTGG + Intronic
1030023393 7:105298158-105298180 TTGGTTGTAGTGTGGCAATGGGG - Intronic
1031505925 7:122582666-122582688 TTGAATATAGTCAGGCAATGTGG + Intronic
1034975670 7:155448198-155448220 GTGGCTCTAGAGAGAAAATGAGG + Intergenic
1036512591 8:9414257-9414279 TTGGCTCTAGACAGGATATGTGG - Intergenic
1037141518 8:15525958-15525980 TTGGCTGTAGGGAGACAGTGAGG + Intronic
1037275513 8:17173954-17173976 TTGGATACAGAGAGGCATCGAGG + Intronic
1039598375 8:38811403-38811425 TATGCTCTAGAGAGGAAATGAGG - Intronic
1039800141 8:40947155-40947177 TGAGCTATGGAGAGGCAAGGAGG + Intergenic
1039865038 8:41493017-41493039 TGGGCTATACAGAGTCAAAGAGG - Intronic
1040023243 8:42759304-42759326 GTGGATTTTGAGAGGCAATGTGG + Intronic
1041564972 8:59266668-59266690 TTGACTTTATAGTGGCAATGTGG - Intergenic
1041699929 8:60777084-60777106 TAAGCTAAAGGGAGGCAATGAGG - Intronic
1042977016 8:74480499-74480521 TTGGCAAGTGAGAGGAAATGAGG + Intronic
1045878599 8:107011802-107011824 TTTGTTATGGAGTGGCAATGTGG - Intergenic
1047514162 8:125539169-125539191 TGGGTTATAGAGAAGCAAAGGGG - Intergenic
1047587363 8:126287915-126287937 TAGCCTATAGATAGTCAATGAGG + Intergenic
1047671370 8:127150673-127150695 TATGCCATAGAGAGTCAATGAGG + Intergenic
1050677462 9:8071777-8071799 GAGTCAATAGAGAGGCAATGCGG - Intergenic
1051589210 9:18758900-18758922 TTAGATATAGAGAGGCAAAAGGG - Intronic
1052875848 9:33562633-33562655 TGTGCTATAGAGAAGCATTGTGG + Intronic
1053500164 9:38581729-38581751 TGTGCTATAGAGAAGCATTGCGG - Intergenic
1054361907 9:64130757-64130779 TGTGCTATAGAGAAGCATTGTGG + Intergenic
1055604855 9:77958030-77958052 TTGCCTTTATAAAGGCAATGTGG + Intronic
1057679588 9:97166412-97166434 TGTGCTATAGAGAAGCATTGTGG - Intergenic
1058844941 9:108947517-108947539 TTGGTTCTAGAGAGGCAAACAGG + Intronic
1059642741 9:116233672-116233694 TTGGCTAAGCAGAGGCAAGGAGG + Intronic
1203706609 Un_KI270742v1:55226-55248 TGTGCTATAGAGAAGCATTGTGG + Intergenic
1203556630 Un_KI270744v1:4258-4280 TGTGCTATAGAGAAGCATTGTGG - Intergenic
1190108014 X:47572996-47573018 TTTGCTAGAGAGAGACAAGGTGG + Exonic
1190454111 X:50608845-50608867 TTGCATCTAGAGAGGCAATAGGG - Intronic
1190937600 X:55010449-55010471 TTGAGTACATAGAGGCAATGTGG - Intronic
1192914042 X:75635163-75635185 TGGGGGAAAGAGAGGCAATGAGG + Intergenic
1193082026 X:77415580-77415602 TTAGCTATAAAGAGAGAATGAGG + Intergenic
1194523808 X:94951035-94951057 TTGGCTATAGAGATGGAAAAAGG + Intergenic
1196206503 X:112946142-112946164 TGGACTATAGAGAGGCATCGAGG + Intergenic
1197744238 X:129920312-129920334 TTGGCTATAGGGAGTCAGTTTGG - Intronic
1201456512 Y:14173042-14173064 TTGGCTATGCAGAGTCCATGGGG - Intergenic