ID: 1092972888

View in Genome Browser
Species Human (GRCh38)
Location 12:13715175-13715197
Sequence CCTGACAGGGTGAATTATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092972884_1092972888 -7 Left 1092972884 12:13715159-13715181 CCAAATTTAAAAATGACCTGACA 0: 1
1: 0
2: 5
3: 32
4: 355
Right 1092972888 12:13715175-13715197 CCTGACAGGGTGAATTATTCTGG 0: 1
1: 0
2: 0
3: 7
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092972888 Original CRISPR CCTGACAGGGTGAATTATTC TGG Intronic
903450186 1:23448357-23448379 CCTGCCAGGGAGAATAAATCTGG + Intronic
904868678 1:33602632-33602654 CCTGACAGGATGATTAGTTCTGG - Intronic
905339105 1:37266184-37266206 CCTGCCATGGTGAGGTATTCAGG + Intergenic
906652482 1:47522555-47522577 CCTGGGAGGGTGCATAATTCTGG - Intergenic
906787771 1:48630831-48630853 CCTGAGAGGGTGTCTTACTCAGG - Intronic
909974026 1:82024452-82024474 CCTGGCAGCATTAATTATTCAGG - Intergenic
910325207 1:85998967-85998989 CCTGACAGTTTCAATGATTCTGG - Intronic
913484539 1:119321869-119321891 CCTGACAGGTTGTATTAATCAGG + Intergenic
915625287 1:157110742-157110764 CCTGACAGGGTGAACAATAGTGG + Intergenic
919642842 1:200062202-200062224 TCTGCCAGGGAGAATTATTTGGG - Intronic
923608205 1:235464528-235464550 GTTAACAGGGTGAATTATTATGG - Intronic
924669770 1:246111777-246111799 CCTCACATGGTGAAGTAGTCTGG - Intronic
1067628097 10:47940283-47940305 CCTCTCAGGGGGCATTATTCTGG - Intergenic
1070616441 10:77972926-77972948 CCTGCCTGTCTGAATTATTCTGG + Intronic
1072255206 10:93614396-93614418 ACTGAAAGGAGGAATTATTCAGG - Intronic
1076929897 10:133525164-133525186 CGTGACAAGGTGAAATAATCAGG - Intronic
1076929905 10:133525212-133525234 CGTGACAAGGTGAAATAATCAGG - Intronic
1076929922 10:133525344-133525366 CGTGACAAGGTGAAATAATCAGG - Intronic
1078403484 11:11047570-11047592 CCTGACAGGCTGGATTCTCCTGG - Intergenic
1078583119 11:12555347-12555369 CCTGACAGTGTGGATTAACCTGG + Intergenic
1078953005 11:16156526-16156548 TTTGACATGCTGAATTATTCAGG - Intronic
1079491132 11:20990235-20990257 CCTAACAGGGAGATTCATTCTGG + Intronic
1079986086 11:27202236-27202258 CCTGACAGGGTGCTTAACTCTGG + Intergenic
1080047087 11:27820796-27820818 CTTGACAGTGTGAATTATGTTGG + Intergenic
1089861872 11:121597158-121597180 CCTTACTGGGTGAACTATTTAGG - Intronic
1091588446 12:1829019-1829041 TCTCACATGGTGAATAATTCAGG - Intronic
1092972888 12:13715175-13715197 CCTGACAGGGTGAATTATTCTGG + Intronic
1106467501 13:30025931-30025953 CCTGATAGGGTGGATGAGTCTGG + Intergenic
1108047511 13:46397109-46397131 CCTGAGAGCCTGAATTATTTTGG + Intronic
1111360381 13:87168166-87168188 ACTGACAGCCTGAATTCTTCAGG + Intergenic
1114567402 14:23642913-23642935 CCTGAAAATGTGAATTGTTCAGG - Intronic
1117276723 14:54201593-54201615 TCTGACAGAGTGAATTGTACAGG + Intergenic
1117439017 14:55743179-55743201 CCTGCCAGGATGACTTTTTCCGG - Intergenic
1123794594 15:23758811-23758833 TCTGACAGAGTGAATAATTCTGG - Intergenic
1130436441 15:83904224-83904246 CCAGGCAGTGTGAATTATGCAGG - Intronic
1133742693 16:8663397-8663419 ACTGACAGGGTGGGTTATTTTGG + Intergenic
1139642862 16:68305425-68305447 GCTGACAGGCTGTATTATCCAGG + Intronic
1144829509 17:18123393-18123415 CGTGAGTGGCTGAATTATTCAGG + Intronic
1160386729 18:78501445-78501467 CCTGCCAGGGTGAAAGTTTCCGG + Intergenic
1167452973 19:49583270-49583292 CCTCACTGGGTGAAGTATCCAGG - Exonic
929157437 2:38800557-38800579 CCTGCCAGGGTGAATGGCTCAGG + Intronic
931487093 2:62705120-62705142 CCTGACAGGGTCATTACTTCAGG + Intronic
932873839 2:75430472-75430494 CTTGAGAGGGGGAATTATCCTGG - Intergenic
933833787 2:86230316-86230338 CCTCCCCTGGTGAATTATTCAGG - Intronic
939204342 2:139080827-139080849 CCTTACAGGGTGCATTAGTCAGG + Intergenic
943167135 2:184343909-184343931 TCTTACAGGTTGAATTATTAAGG - Intergenic
944728298 2:202494934-202494956 CCTGACAGGGTGCGTGATGCGGG + Intronic
1170015832 20:11781014-11781036 CCAGACAGGGTTAATGATTGAGG - Intergenic
1170581030 20:17699797-17699819 CCAGACAGGCTGATTTCTTCTGG + Intronic
1170734846 20:19005801-19005823 CCTGAAAGGGTGCATTACTGAGG - Intergenic
1171901135 20:30858570-30858592 CAATACAGGGTGACTTATTCAGG - Intergenic
1172151743 20:32795759-32795781 CCTGACAGGGTGGATGAGCCAGG - Intronic
1173076528 20:39824611-39824633 CCTGACAGGGAAAATGAATCAGG - Intergenic
1177344788 21:19854592-19854614 GCTGACAGGGGGCATTATTTTGG + Intergenic
1180334499 22:11564523-11564545 CAATACAGGGTGACTTATTCAGG - Intergenic
1183855552 22:40631271-40631293 ACTGACTGGGTGAATTAGTTTGG - Intronic
949455247 3:4231085-4231107 TCTGGCATGGTGAATTGTTCAGG - Intronic
951754847 3:26078947-26078969 CCTGTCAGTGTAATTTATTCAGG + Intergenic
953841433 3:46392925-46392947 CCGGACAGGGTGACTCCTTCGGG - Intergenic
959254159 3:103989493-103989515 CCTGACAGGGGGCATTTTTTGGG + Intergenic
960335447 3:116411873-116411895 CCAGAGAGGGTTAATTATTGAGG + Intronic
963601275 3:147380898-147380920 CCTGACAGGGTGTGTGATTGGGG - Intergenic
963909601 3:150804773-150804795 TTTCAAAGGGTGAATTATTCAGG - Intergenic
964000269 3:151762746-151762768 CATGACAGGGTGAATTGTATAGG + Intergenic
964067113 3:152593538-152593560 GCTGACAGAGTGAATCAGTCAGG + Intergenic
965320937 3:167250657-167250679 GCTGACAGGGGGCATTGTTCTGG - Intronic
970356341 4:15256970-15256992 CCTGACAGGCTAAATTATCTTGG + Intergenic
976813913 4:89124698-89124720 CAGGACAGGGTGCATTATTGTGG + Intergenic
979663221 4:123282611-123282633 CCAGACAGGGTGTATTCTTAAGG - Intronic
981818413 4:148857716-148857738 GGTGACAGGATGAATTATTGTGG - Intergenic
984401306 4:179268712-179268734 ATTGACAGAGTGTATTATTCTGG - Intergenic
985528843 5:421980-422002 CCTGGCACGGTTAATTATTCGGG + Intronic
987116395 5:14729832-14729854 CCGGACAGAGTGGATTCTTCAGG + Intronic
987220944 5:15789916-15789938 CCTGCCTGGGTGAATTAGTGAGG + Intronic
988835318 5:35026610-35026632 CCAGACAGGGTAAGTTAATCAGG + Intronic
991371430 5:65924948-65924970 CCTGCCAGGCTGAATTATTAGGG + Intergenic
995419944 5:111953198-111953220 CCTTGCAGGGTGAATGATTTAGG + Intronic
995985014 5:118160620-118160642 CATGAGAGGGTCAATGATTCAGG + Intergenic
999640611 5:153668828-153668850 TCTGGCAGGGTGACATATTCTGG + Intronic
999670541 5:153955645-153955667 CAAAACAGGGTGAATTATTGGGG - Intergenic
1000679721 5:164168453-164168475 GATGACATGGTGAATTAGTCAGG + Intergenic
1001229131 5:169970695-169970717 CCTGCCAGGGTGAAATAATCAGG + Intronic
1001726248 5:173903812-173903834 CCTGGCAGGCAGTATTATTCAGG + Intronic
1017234080 6:152101236-152101258 CCTGAAAAGGAAAATTATTCAGG + Exonic
1018509319 6:164507840-164507862 CCTGACAGGGGAGTTTATTCTGG - Intergenic
1018723996 6:166596792-166596814 CCTCACAGAGTGTATTAGTCAGG - Intronic
1018914475 6:168124671-168124693 CCTTCCAGGGTGATTTATACAGG + Intergenic
1020551440 7:9610841-9610863 CATGAAAGGGTGAAGTATTGGGG + Intergenic
1021250035 7:18313442-18313464 CCTGACACTGAGAATTATTAAGG + Intronic
1022254571 7:28643329-28643351 ACCGACAGGGTGAATTATATGGG + Intronic
1027431151 7:78114036-78114058 CCTGACAGGGTAACTTGTTCAGG + Intronic
1035495450 7:159321438-159321460 CCTCCCAGGGTGACTTGTTCTGG - Intergenic
1037228381 8:16623433-16623455 CCTGACAGGGTGGAGAATTGAGG - Intergenic
1040549836 8:48429443-48429465 CCTCACAGGGTCAAATATGCTGG - Intergenic
1044144757 8:88698317-88698339 CCTTACAGGGCAAATTATTATGG - Intergenic
1046652656 8:116855083-116855105 TCTGACAGGGTGAAATCTTGAGG - Intronic
1053149939 9:35736941-35736963 CCTGACTGCGTGAAATGTTCAGG - Exonic
1055722956 9:79196344-79196366 TTTTACAGGTTGAATTATTCTGG - Intergenic
1203368768 Un_KI270442v1:281941-281963 CAATACAGGGTGACTTATTCAGG + Intergenic
1194096834 X:89651118-89651140 CCTGACAGTGTTAATTGTTGTGG - Intergenic
1200449853 Y:3312494-3312516 CCTGACAGTGTTAATTTTTGTGG - Intergenic