ID: 1092973318

View in Genome Browser
Species Human (GRCh38)
Location 12:13719931-13719953
Sequence GGCTTACAAGGTAGCTGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 83}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092973318_1092973321 -6 Left 1092973318 12:13719931-13719953 CCAGTCCAGCTACCTTGTAAGCC 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1092973321 12:13719948-13719970 TAAGCCTTTAAACAGACAGAAGG 0: 1
1: 0
2: 0
3: 19
4: 180
1092973318_1092973323 15 Left 1092973318 12:13719931-13719953 CCAGTCCAGCTACCTTGTAAGCC 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1092973323 12:13719969-13719991 GGAACAACTATCCCAAACCATGG 0: 1
1: 0
2: 1
3: 10
4: 96
1092973318_1092973324 16 Left 1092973318 12:13719931-13719953 CCAGTCCAGCTACCTTGTAAGCC 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1092973324 12:13719970-13719992 GAACAACTATCCCAAACCATGGG 0: 1
1: 0
2: 0
3: 13
4: 98
1092973318_1092973327 28 Left 1092973318 12:13719931-13719953 CCAGTCCAGCTACCTTGTAAGCC 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1092973327 12:13719982-13720004 CAAACCATGGGACCTGTGCAAGG 0: 1
1: 0
2: 1
3: 9
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092973318 Original CRISPR GGCTTACAAGGTAGCTGGAC TGG (reversed) Intronic