ID: 1092975215

View in Genome Browser
Species Human (GRCh38)
Location 12:13738177-13738199
Sequence TCTGAAGTACTGCAGATAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092975215 Original CRISPR TCTGAAGTACTGCAGATAAA AGG (reversed) Intronic
901194597 1:7433345-7433367 TCTGAAGGGCTGCAGAGGAATGG - Intronic
902461066 1:16577248-16577270 TCTGAAGTACAGCAGCTCAGTGG - Intronic
903351238 1:22717747-22717769 TCTGTAGGACTTCAGAGAAAGGG - Intronic
908029238 1:59982290-59982312 TTTGATGTATGGCAGATAAATGG + Intergenic
908513654 1:64870720-64870742 CCTGAAGAACTTCAGATTAATGG + Intronic
908642328 1:66238908-66238930 TCTAAAATATTGCAGATAAATGG - Intronic
910851610 1:91654770-91654792 TCTGAAGTTCTGAAGACACAAGG - Intergenic
911255697 1:95630588-95630610 TCTGACGTATTCCACATAAATGG - Intergenic
913377114 1:118164829-118164851 TCTGAATTTCTTCACATAAATGG + Intronic
914538301 1:148587232-148587254 TCTGAAGTACAGCAGCTCAGTGG - Intronic
915801042 1:158794011-158794033 TCAGGATTCCTGCAGATAAAAGG - Intergenic
917138354 1:171809656-171809678 GCTGAAGTAGTTCAGAGAAAAGG - Intronic
917611626 1:176694471-176694493 TCTGAAGTACCTCACATAACTGG - Intronic
917878599 1:179310462-179310484 TCTGCACTACTTCAGAAAAATGG - Intronic
918296199 1:183159785-183159807 TATAAAGTACTTCACATAAATGG + Intergenic
921006216 1:211095897-211095919 TCCGAATAACTGAAGATAAAGGG - Intronic
921464118 1:215464832-215464854 TCTTAAGTACAGAAGATAAATGG + Intergenic
922189912 1:223309286-223309308 TTTGAATGGCTGCAGATAAAAGG + Intronic
924125067 1:240842023-240842045 TATGAAATACTGCACGTAAAAGG + Intronic
1064305633 10:14163749-14163771 ACAGAATTACTGCAAATAAACGG + Intronic
1064722688 10:18245967-18245989 ACTGAAGCACTGGAAATAAATGG + Intronic
1065669589 10:28101589-28101611 TATGAAGTACTCCAGAGCAAGGG + Intronic
1073714172 10:106083515-106083537 TCTGAAGTTCTGCAGAAATATGG - Intergenic
1080781864 11:35437071-35437093 TATGAAGCATTGCATATAAATGG + Intronic
1083829479 11:65222296-65222318 TATGATGTACTGCAAAAAAAGGG + Intergenic
1086289739 11:85293637-85293659 TATGAACTATTGCAGATTAAAGG + Intronic
1086631011 11:89019730-89019752 TGGGAAGTATTGGAGATAAAAGG - Intronic
1087882822 11:103438756-103438778 TGTGAAGTACTGGAGATATCAGG + Intronic
1088351905 11:108899184-108899206 CCAGAACTACTGCAGAGAAAAGG - Intronic
1088692282 11:112338175-112338197 TCTGAAATACTGCAGGTCCAGGG - Intergenic
1088861297 11:113802170-113802192 TCTGAAGTAATGCAATTATAGGG - Intronic
1091355184 11:134932335-134932357 TTTAAAATACTGCATATAAATGG - Intergenic
1092156041 12:6282105-6282127 TCTGAAAGACAGCAGAGAAACGG - Intergenic
1092975215 12:13738177-13738199 TCTGAAGTACTGCAGATAAAAGG - Intronic
1093836023 12:23829641-23829663 TCTTAAGTCCCTCAGATAAATGG - Intronic
1094176368 12:27545934-27545956 TCTGAAGTACAGCTGACAAGAGG - Intronic
1095504597 12:42881366-42881388 ACTGAAGCACTGGAGACAAAAGG - Intergenic
1097840527 12:64317326-64317348 TATGTACTACTGAAGATAAAGGG + Intronic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1101758196 12:107638056-107638078 TCTGAAATGATCCAGATAAAGGG - Intronic
1102111530 12:110368941-110368963 TCTGCAGTACTGATGATTAAGGG + Intergenic
1102337768 12:112096904-112096926 TCTGAAGGTCTGCCCATAAATGG + Intronic
1105272059 13:18886104-18886126 TTTTAAGTACTGCAGAACAAGGG + Intergenic
1105632361 13:22183037-22183059 TCTGTAGTACTGAAGGCAAAAGG - Intergenic
1105774267 13:23642410-23642432 AATGAAGTACTGCACATAAAGGG - Intronic
1107221011 13:37979952-37979974 TCTGAAGGACTAGATATAAAAGG + Intergenic
1107751185 13:43569135-43569157 ATTGAAGTATTTCAGATAAAAGG - Intronic
1107902356 13:45030018-45030040 TGTTAAGTACAGCATATAAATGG - Intronic
1108890841 13:55257174-55257196 GCTGAATTACTCCAGTTAAAAGG + Intergenic
1108927811 13:55775273-55775295 TCTGAAGTATTACAGAGAAAGGG + Intergenic
1109015612 13:57008864-57008886 TCTGCACTATTGCAGATAAGGGG - Intergenic
1109145331 13:58773049-58773071 TCAGAGGTAGAGCAGATAAATGG - Intergenic
1110344839 13:74433936-74433958 AATGAAGTACTACATATAAATGG - Intergenic
1110849634 13:80230738-80230760 AATGAAGTACTGAAGTTAAATGG + Intergenic
1110852894 13:80264583-80264605 TCTGAAATATTGCAGATACAGGG + Intergenic
1110969457 13:81742661-81742683 TGTTAAGTACAGCATATAAATGG - Intergenic
1112614706 13:100991751-100991773 TCTTAAATACAGCAGATGAATGG - Intergenic
1113354152 13:109562089-109562111 TCACAAGTACTGCAGAAAATAGG + Intergenic
1114823058 14:26044725-26044747 TCTGAAGGACTATAGATACAGGG + Intergenic
1115417935 14:33158587-33158609 TCTAAGGTACTGCAGAGAGAGGG + Intronic
1115610585 14:35045623-35045645 TCTGAGGTTCTGCAGGTAAATGG - Intronic
1115979354 14:39032119-39032141 TATCAAGTACTGCAAATAAAAGG - Exonic
1116228416 14:42183127-42183149 TATGAAGTACTTCAGATATTTGG + Intergenic
1118231165 14:63951222-63951244 TCTGAAGTCCTGCATTTGAAAGG - Intronic
1119682503 14:76603434-76603456 TGTGAAGCACTGCAGATGTAGGG + Intergenic
1121839764 14:97123461-97123483 ACAGAACTACTGCAGAGAAATGG - Intergenic
1123486501 15:20744758-20744780 TTTTAAGTACTGCAGAACAAGGG + Intergenic
1123542989 15:21313808-21313830 TTTTAAGTACTGCAGAACAAGGG + Intergenic
1125074018 15:35591518-35591540 CCTAAAGTACTCCAGATGAAGGG - Intergenic
1125187723 15:36951047-36951069 TATGAAGTATTGCACATAATTGG - Intronic
1126675156 15:51154600-51154622 TCTGAAGTACAGCATAAAACAGG + Intergenic
1126830903 15:52603780-52603802 TTTGAACTAATGAAGATAAAGGG + Intronic
1127262073 15:57333762-57333784 TCTGAAGCATTTCAGATAAGGGG - Intergenic
1130173839 15:81547122-81547144 TCTGAAGGGCTGCAGAGACATGG - Intergenic
1202951308 15_KI270727v1_random:40938-40960 TTTTAAGTACTGCAGAACAAGGG + Intergenic
1135827402 16:25741579-25741601 AATGAAATACTGCAGACAAAAGG - Intronic
1136608087 16:31349859-31349881 TGTGAAGAACTGGGGATAAAAGG + Intergenic
1138952166 16:61926358-61926380 TGTGAAGTATTGGAGATTAATGG - Intronic
1138988424 16:62360963-62360985 TCTTAAGTGCTGGAGATAAAAGG + Intergenic
1141295278 16:82762413-82762435 TCTCAAGTGCTGTAGCTAAAGGG + Intronic
1141304885 16:82853007-82853029 TCTGTACTACAGCAAATAAATGG + Intronic
1144327945 17:14199750-14199772 TCTATGGTGCTGCAGATAAAGGG - Intronic
1145048223 17:19636194-19636216 TCTGAAGTATTTCAGAAAATAGG - Intergenic
1146614171 17:34338938-34338960 TCAGAAGTAATGCAAACAAATGG - Intergenic
1148984124 17:51606687-51606709 TCTATAGTACTTCAGATATAAGG - Intergenic
1153338386 18:3948480-3948502 TCTCCAGCACTGCAGATAAGTGG + Intronic
1153631363 18:7073353-7073375 TCGGAAGTTCTGGAGATAGATGG - Intronic
1154981832 18:21508771-21508793 TCTGCAAAAGTGCAGATAAAGGG - Intronic
1156190741 18:34717428-34717450 TCTGTATTTCTGTAGATAAAAGG - Intronic
1157785292 18:50476360-50476382 ACTGAAGTACTGTATAGAAATGG - Intergenic
1158511839 18:58097540-58097562 TCTGACTCACTCCAGATAAAGGG - Intronic
1158746508 18:60205872-60205894 TCATAAGTATTTCAGATAAAGGG - Intergenic
1166998655 19:46732100-46732122 ACTGAAGGACTGCAGCTAAGGGG - Intronic
1167025807 19:46917203-46917225 TCTTAAGTACTGCATATAAGTGG + Intergenic
1168367215 19:55798859-55798881 GCTGAAGTACTGCAGATAGGTGG + Intronic
1202677499 1_KI270711v1_random:20988-21010 TCTGAAGTACAGCAGCTCAGTGG - Intergenic
925685798 2:6471830-6471852 TCTGAAGTGCTGCAGTTATGTGG - Intergenic
926757583 2:16248816-16248838 CCTGAAGGTCTGCAGATAACAGG - Intergenic
928498530 2:31862131-31862153 TCTCAAGTAATGCTGATAACTGG - Intergenic
929950209 2:46404319-46404341 TCTGAAGGAATGCAGATCATGGG - Intergenic
930306144 2:49677225-49677247 TCTGAATTAATGAAAATAAAGGG - Intergenic
933810649 2:86030956-86030978 TCTGTTGTACTGAAGATTAAAGG + Intronic
935393490 2:102580277-102580299 TCTGGAGCAGTGCAGAGAAAGGG - Intergenic
935861143 2:107331141-107331163 TCAGAAGTAACACAGATAAATGG + Intergenic
937022324 2:118668848-118668870 TCTGCAGGAATGCAGAGAAAAGG + Intergenic
940364307 2:152829767-152829789 TCTGAAGTACTGCACCTTCAGGG + Intergenic
941133359 2:161682396-161682418 TCGTAAGTATTGCAGGTAAAGGG + Intronic
941434552 2:165453071-165453093 TCTGAATTTCTGCAGCTAAGTGG + Intergenic
943974802 2:194460697-194460719 TCTGAAATACTGAAATTAAAGGG + Intergenic
945724410 2:213458199-213458221 TATGAAGTAATGATGATAAATGG - Intronic
946157886 2:217818751-217818773 ACTGAAGTGCTGCAGAGAGATGG + Exonic
1168786739 20:545830-545852 GCTGAAGCACTGCAAATAAAGGG + Intergenic
1169803163 20:9532263-9532285 TGAGAAGCAATGCAGATAAATGG - Intergenic
1169852023 20:10062799-10062821 TCTTATTTACTGAAGATAAAAGG - Intergenic
1173555416 20:43962144-43962166 TCTGCATTACTGCAGATTTATGG - Intronic
1173668410 20:44779733-44779755 CCTGAAGAACTGCACAGAAATGG - Intronic
1177489155 21:21799778-21799800 CCTGAAGTATTGCAGAGAAGAGG + Intergenic
1179847283 21:44118749-44118771 TCTGAAATGCTGCAGAGAACGGG - Exonic
1182651199 22:31852676-31852698 TCTGAAATATTACAGATGAAGGG - Intronic
1182714406 22:32344851-32344873 TCTGAAGCAGTGCAGATACAGGG - Intergenic
1184890359 22:47375395-47375417 TCTGAAGTCCTGCAGAGGACTGG - Intergenic
950495724 3:13333235-13333257 TCTGAAGTCTTGCAGAGAAGGGG - Intronic
952108024 3:30091760-30091782 TTTTAGGTACTGCATATAAATGG + Intergenic
952235903 3:31479964-31479986 TGTGACTTACTTCAGATAAATGG + Intergenic
952586623 3:34900504-34900526 TCTGAAGTCCTCCAGGTAGATGG - Intergenic
956047905 3:65215849-65215871 TCTGACTTACTGCAGAAAAGAGG + Intergenic
956413725 3:69005190-69005212 TCTGCAGTACTGAAGATAACGGG + Exonic
956883052 3:73530891-73530913 TCTGAAGAAAACCAGATAAATGG + Intronic
956992846 3:74788485-74788507 TATGAACTACTGAAAATAAATGG + Intergenic
957150227 3:76476899-76476921 TCAGAGGTAATGCAGATGAATGG + Intronic
957178541 3:76845664-76845686 TATAAAGCACTGCAGAGAAAGGG - Intronic
957835556 3:85584421-85584443 TTTGCATTACTGTAGATAAACGG - Intronic
958679026 3:97302156-97302178 TCTGAAATACTGTAGAGAAAGGG - Intronic
960459198 3:117912713-117912735 TTTGAATTAATGCAGATAAGAGG - Intergenic
962455378 3:135560557-135560579 TCTGAAGTGCTGGAAATATAGGG - Intergenic
962978292 3:140465231-140465253 TCTGAATAATTGCAGAGAAAAGG - Intronic
963254501 3:143131299-143131321 CCTTAAGTAATGCAGATAAATGG + Intergenic
965104134 3:164337757-164337779 TTTGAAGTGCTTCAGGTAAATGG - Intergenic
966352471 3:179045795-179045817 TATGAAGTCCTTCAGATATAAGG - Intronic
970988777 4:22189456-22189478 TCAAAAATACTGCTGATAAAAGG + Intergenic
975971092 4:80038110-80038132 TCTGAGGAATTGCAGAGAAATGG - Intronic
976903904 4:90212629-90212651 TCTGACGTACTGGAAATAAGTGG + Intronic
977776988 4:100932401-100932423 TGTGAAGTAAGGCATATAAAGGG + Intergenic
978915270 4:114118442-114118464 TCTTAGGCACTGGAGATAAAGGG + Intergenic
980191347 4:129529081-129529103 TATGAGGCACTGAAGATAAAAGG - Intergenic
981776997 4:148380180-148380202 TATGCAGTACTTCACATAAATGG + Intronic
986285727 5:6357088-6357110 TATGATGTACTGTAGATAATCGG - Intergenic
987228370 5:15867492-15867514 TCAGAATTACTGAAGATACAAGG - Intronic
988260872 5:28884482-28884504 TCAGAAGTTCTGAAAATAAAAGG + Intergenic
989728725 5:44621759-44621781 TGTGAAATATTGCAGATGAAAGG + Intergenic
992141086 5:73797722-73797744 TCTGAGGAAATGCTGATAAATGG + Intronic
993188415 5:84649705-84649727 TTTGAAGTTCTGTAGACAAAAGG + Intergenic
995407823 5:111821129-111821151 TCTGAAGTATTGCAGAGCAGTGG - Intronic
996388988 5:122939755-122939777 TCTGGGGTACTGCAGATTATTGG - Intronic
997262577 5:132476046-132476068 TCGGCAGTACTGGAGATAGAAGG - Intergenic
997627403 5:135340300-135340322 TGTGAGATAATGCAGATAAAGGG + Intronic
997903366 5:137789516-137789538 TCTCAAGTTCTACAAATAAATGG - Intergenic
998219496 5:140265070-140265092 TTTAAAGTATAGCAGATAAAAGG - Intronic
998564690 5:143206660-143206682 TCTGAAGTACTGCATGAAGAAGG - Intronic
998834940 5:146194361-146194383 CATGGAGTACAGCAGATAAAAGG - Intergenic
998851590 5:146356027-146356049 ACTGAAGAACTGAAGAAAAATGG + Intergenic
1000836914 5:166166626-166166648 TCTGAAATACTGGAAAGAAAGGG - Intergenic
1004861928 6:19813140-19813162 TCTGAAGTAGTGCAGAGTAAAGG - Intergenic
1005379963 6:25223984-25224006 TCTGAAGTCCTGGTGAAAAAGGG - Intergenic
1006662735 6:35661947-35661969 ACTAAAGTAATGCACATAAAGGG + Intronic
1007049276 6:38809899-38809921 TCAGAATTAATACAGATAAAGGG - Intronic
1011839211 6:91475652-91475674 TCTGAAGTACTGGAATTACAAGG - Intergenic
1014565940 6:122947535-122947557 TCTGCAGTACTGCAGACACCAGG + Intergenic
1014626519 6:123732742-123732764 TCTGAAGAAATGTACATAAATGG + Intergenic
1016657325 6:146536303-146536325 TCTATAATACTGAAGATAAAAGG + Intergenic
1021248936 7:18299799-18299821 TCTGAAGCAGTGCGGAGAAAAGG + Intronic
1022355042 7:29606756-29606778 TCTGGATTACTGCAGATCTAGGG - Intergenic
1026381183 7:69800867-69800889 TAAGAAGTACTCCAGATAGAAGG - Intronic
1027859213 7:83554022-83554044 AATGAAATACTTCAGATAAATGG - Intronic
1034085287 7:148316912-148316934 GCTGAACTATTCCAGATAAATGG - Intronic
1035909161 8:3546709-3546731 TAGGAATTACTGAAGATAAAAGG + Intronic
1036741884 8:11370503-11370525 TCTTAAGGACTTCAGACAAATGG - Intergenic
1036977507 8:13430564-13430586 TCAAAAGTACTGCAGAAAAAAGG - Intronic
1038990115 8:32858853-32858875 TCTAAAGTAATGCAGATCAAGGG + Intergenic
1039345427 8:36698939-36698961 TCAGAAGTACAACAGATAAATGG - Intergenic
1039974713 8:42352700-42352722 TCTGTAGTACAGTAGATATAGGG + Intronic
1041958032 8:63578222-63578244 TCTGAAATATTTCAGATGAATGG - Intergenic
1043274451 8:78375821-78375843 TCTTAAGAACAGTAGATAAAAGG + Intergenic
1044465521 8:92499224-92499246 TCTGAATTACTGTTGACAAATGG - Intergenic
1046842826 8:118879631-118879653 ACTGAAGTTATGCAAATAAAAGG - Intergenic
1047824361 8:128557387-128557409 TATGAGGTTCTGCAGAGAAAAGG + Intergenic
1048624542 8:136170887-136170909 TCTTAATTACTGCAGCTATATGG + Intergenic
1050708303 9:8429604-8429626 TCTGAAATATTTCATATAAAAGG + Intronic
1052685442 9:31749789-31749811 GCTGAATTAGTGCAGATGAAGGG + Intergenic
1053608591 9:39686441-39686463 TCTGAAGTACACCAGATTATAGG + Intergenic
1053866440 9:42442798-42442820 TCTGAAGTACACCAGATTATAGG + Intergenic
1054244936 9:62655969-62655991 TCTGAAGTACACCAGATTATAGG - Intergenic
1054559061 9:66690500-66690522 TCTGAAGTACACCAGATTATAGG - Intergenic
1055311119 9:74981263-74981285 TCTGAAGCAGTGCAGATATAGGG - Exonic
1055466173 9:76568998-76569020 TCTGAAGGACAGCAAAGAAATGG + Intergenic
1057114817 9:92510890-92510912 TCTGGAGTCTGGCAGATAAAAGG - Intronic
1058061843 9:100505648-100505670 CCTGAAGTACTGCAAAGGAAAGG - Intronic
1060238061 9:121880108-121880130 TCTGAAGTCCTTCAGGCAAAAGG - Intronic
1060849760 9:126864838-126864860 ACTGAAGCACCGCAGACAAAAGG - Intronic
1062719647 9:138032122-138032144 TCAAAAATACTACAGATAAAAGG - Intronic
1186582171 X:10831700-10831722 TATGAATTACTGCAGATTACTGG - Intronic
1187253663 X:17622251-17622273 TTTGAAGTCCTGGAGATACAAGG + Intronic
1188684098 X:33048007-33048029 TCTGAAACACTGAAGATCAATGG + Intronic
1190439035 X:50458349-50458371 TCTATAATACTGAAGATAAAAGG + Intronic
1190540664 X:51474541-51474563 TCTGATGTAGGGGAGATAAAAGG + Intergenic
1193349450 X:80443247-80443269 TCTGAAGTACTGCAGCTTGCTGG + Exonic
1194675050 X:96784431-96784453 CCTAAAGTACTGAAGCTAAAGGG - Intronic
1195433430 X:104814980-104815002 TTTGAATTGCTGCAAATAAATGG + Intronic
1198619481 X:138490366-138490388 TCTCAGTGACTGCAGATAAAGGG + Intergenic
1199210110 X:145198282-145198304 TCTGAAGTATTTAAGAGAAAAGG - Intergenic
1199834848 X:151579002-151579024 TTTAAAATACTGCAGAAAAATGG + Intronic