ID: 1092979059

View in Genome Browser
Species Human (GRCh38)
Location 12:13775425-13775447
Sequence GCCTCTCCGGGTAAATGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 96}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092979052_1092979059 28 Left 1092979052 12:13775374-13775396 CCTCTCTTCCAATGTTTTTCCTT 0: 1
1: 1
2: 2
3: 59
4: 667
Right 1092979059 12:13775425-13775447 GCCTCTCCGGGTAAATGAGATGG 0: 1
1: 0
2: 0
3: 6
4: 96
1092979054_1092979059 9 Left 1092979054 12:13775393-13775415 CCTTAACTGTGAAGTGAGTTAGG 0: 1
1: 0
2: 0
3: 9
4: 134
Right 1092979059 12:13775425-13775447 GCCTCTCCGGGTAAATGAGATGG 0: 1
1: 0
2: 0
3: 6
4: 96
1092979053_1092979059 20 Left 1092979053 12:13775382-13775404 CCAATGTTTTTCCTTAACTGTGA 0: 1
1: 0
2: 2
3: 24
4: 316
Right 1092979059 12:13775425-13775447 GCCTCTCCGGGTAAATGAGATGG 0: 1
1: 0
2: 0
3: 6
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092979059 Original CRISPR GCCTCTCCGGGTAAATGAGA TGG Intronic
902953768 1:19910050-19910072 GTCTCACTGGGTACATGAGAAGG + Exonic
905799094 1:40832120-40832142 TCCTCTTCAGGAAAATGAGAGGG + Intronic
906080709 1:43086472-43086494 GCCACTAAGGGTAAAGGAGAAGG - Intergenic
907207603 1:52787427-52787449 TCCTCTGAGGGGAAATGAGAGGG + Intronic
909443550 1:75724262-75724284 TTCTCTCCGGGTAAAGGTGAAGG + Intergenic
911596163 1:99800854-99800876 GCCTCACCGGGGAAATGCAAGGG - Intergenic
915777968 1:158511940-158511962 GCTTCTCTGGGTAACTGAAAAGG + Intergenic
916961840 1:169896493-169896515 GCCTCACAGGGCCAATGAGAAGG - Intergenic
919476163 1:198035612-198035634 GCCTCTAAGGGTGAAGGAGAAGG - Intergenic
920829198 1:209449934-209449956 GCCGCTCAGGGTGAAGGAGAAGG - Intergenic
1063823825 10:9870028-9870050 GCCTCTCTGGTTAAAGGAGTGGG - Intergenic
1064664004 10:17631475-17631497 GCCTCTAAGGGTGAAGGAGAAGG + Intergenic
1069057290 10:63857626-63857648 GCCTCACCCGGGAAATGCGAGGG - Intergenic
1070979542 10:80633173-80633195 GCCTCTCAGGGTCATGGAGATGG + Intronic
1074373064 10:112915937-112915959 CCCTCCCTGGGTAATTGAGAAGG + Intergenic
1074930246 10:118117671-118117693 GCCTGTCAAGGTAAAGGAGAAGG + Intergenic
1079666400 11:23111791-23111813 GCCTGTGAGTGTAAATGAGAAGG - Intergenic
1083300360 11:61736913-61736935 GCCACTCCTGGAAAATCAGAAGG + Intronic
1083739094 11:64698477-64698499 GCCTCTTCTGCAAAATGAGAGGG + Intronic
1084266434 11:68007805-68007827 GCATCTGTGGGTGAATGAGAGGG - Intergenic
1084355346 11:68634688-68634710 GCCACTCAGGGTGAAGGAGAAGG - Intergenic
1089180743 11:116581316-116581338 CCCCCTCCGGGTAAGAGAGAGGG + Intergenic
1089891872 11:121889609-121889631 GCCTGCCCAGGTCAATGAGAGGG + Intergenic
1092979059 12:13775425-13775447 GCCTCTCCGGGTAAATGAGATGG + Intronic
1093914538 12:24786679-24786701 GCCTCTCCGGGTATTTAACAAGG + Intergenic
1094575320 12:31679636-31679658 GCCTCTCAGGGTAAAACATAAGG + Intronic
1095878485 12:47107014-47107036 CCCTGGCCGGGTAACTGAGATGG - Intronic
1102615809 12:114153191-114153213 GCCTCTTAGAGTTAATGAGAGGG + Intergenic
1108027677 13:46195556-46195578 GCTACTGAGGGTAAATGAGAAGG + Intronic
1113780745 13:112975734-112975756 GATTTTCCAGGTAAATGAGAAGG + Intronic
1114365742 14:22025713-22025735 GCCGCACGGGGTACATGAGAAGG + Intergenic
1115256053 14:31403499-31403521 GGATCTCCAGGTAAATGACAGGG - Intronic
1115507866 14:34110072-34110094 GTCTCTCAGTGTAACTGAGAAGG + Intronic
1115904577 14:38191642-38191664 GCCACTCAGGGTGAAAGAGAAGG - Intergenic
1116703528 14:48267297-48267319 GCCGCTCAGGGTGAAGGAGAAGG + Intergenic
1116804830 14:49483136-49483158 GGCTCTCCAGGTAAAGGACATGG - Intergenic
1121406079 14:93720173-93720195 GCATCTCCTGGAAAATGAGTGGG - Exonic
1127380805 15:58429125-58429147 GGCTCTCCTGGAAAATGACAAGG - Intronic
1127458310 15:59175253-59175275 CACTCTCAAGGTAAATGAGAAGG - Intronic
1130233446 15:82113814-82113836 GCCCCTCTGGGGAAATGAGAAGG - Intergenic
1130747847 15:86675218-86675240 GTGTCTCCTGGTAAATGAGGAGG + Intronic
1130764656 15:86857737-86857759 GGATGTCCTGGTAAATGAGACGG - Intronic
1130812077 15:87390219-87390241 GCCTCTCAGGAAAAATGACATGG + Intergenic
1132340207 15:101073493-101073515 GCCGCTCAGGGTGAAGGAGAAGG - Intronic
1138732247 16:59208244-59208266 GCCTCTCAATGTACATGAGAGGG + Intergenic
1141057629 16:80833315-80833337 ACCTCTCCTAGTACATGAGATGG - Intergenic
1145038350 17:19556915-19556937 GTGTCTGCGGGTAAATGAAATGG + Intronic
1153171221 18:2318196-2318218 TCCTCTCCTGGTAAATGAAGGGG - Intergenic
1164459427 19:28434580-28434602 GCCTCTAAGGGTGAAGGAGAAGG + Intergenic
1164553930 19:29235263-29235285 GCCTCTCCAGGTCACTGTGAGGG + Intergenic
927699715 2:25260047-25260069 AGCTCTCCGGGTAATTGATAGGG - Intronic
929076898 2:38085551-38085573 GCCGCTCAGGGTGAAGGAGAAGG + Intronic
931042488 2:58315112-58315134 GCCACTCAGGGTGAAGGAGAAGG - Intergenic
937953879 2:127408399-127408421 GCCGCCCCGGGTAAAGGACAGGG + Intergenic
940529983 2:154868280-154868302 GCCACTCAGGGTGAAGGAGAAGG - Intergenic
940676022 2:156724864-156724886 GCCACTCAGGGTGAAGGAGAAGG + Intergenic
946095814 2:217273382-217273404 GTGTCTCCGGGTAAAGGAGTAGG - Intergenic
1169244333 20:4014302-4014324 GCCTCCCTGTGTTAATGAGAAGG - Intronic
1169499791 20:6148308-6148330 GCCTCTCCAGGCCAATGGGAAGG + Intergenic
1169733223 20:8809542-8809564 GGCTCTCCTGGAAAATGAAAGGG - Intronic
1177858510 21:26425933-26425955 GCCTCTCAGGGCCAATGGGAAGG - Intergenic
1178633875 21:34285746-34285768 GCCTCACAGGGTAAAAGTGAGGG + Intergenic
951116974 3:18875151-18875173 GCCTCTCCGGATCAATGAAGAGG - Intergenic
952879650 3:37975550-37975572 TCCTCTCCGTGTACATAAGATGG - Intronic
960338914 3:116451274-116451296 GCCTTTCCGGGTAAAAGAAATGG + Intronic
962904354 3:139788748-139788770 GAATCCCCGGGGAAATGAGACGG + Intergenic
965423439 3:168491064-168491086 GCCTCTACTGATAAAGGAGAGGG + Intergenic
966278982 3:178208141-178208163 GCCTCTAAGGGTGAAGGAGAAGG - Intergenic
975778858 4:77819229-77819251 GCGTCCCCGGGGAAATGAGGTGG - Exonic
980388705 4:132119133-132119155 GCCGCTCAGGGTGAAGGAGAAGG - Intergenic
983023672 4:162710139-162710161 GCCGCTCAGGGTTAAGGAGAAGG - Intergenic
1004575019 6:16886933-16886955 GCCGCTCAGGGTGAAGGAGAAGG - Intergenic
1004876913 6:19965042-19965064 GCTTCTCCGGGTATTTGTGAAGG - Intergenic
1005014879 6:21366247-21366269 GCCTCTAAGGGTGAAGGAGAAGG + Intergenic
1005183055 6:23128497-23128519 GCCACTCCTGTTAAATGTGAGGG - Intergenic
1006478408 6:34272800-34272822 GCCTCTCAGGGTAGATGTGAAGG + Intergenic
1007799060 6:44376361-44376383 GCCTTTCTGGGTGAAGGAGAAGG + Exonic
1011999651 6:93637363-93637385 CCCTTTCCGAGTCAATGAGAGGG - Intergenic
1017906318 6:158759419-158759441 GCCTCTGAGGGTAACTGAGAGGG + Intronic
1019350744 7:552830-552852 GCCTCCCCGGGGAAAGGGGAGGG + Intronic
1020003458 7:4768708-4768730 GGCTCTCCGGGCAAATCAGAAGG + Exonic
1020826243 7:13032728-13032750 GACTCTCAGGGTGAATGAGGAGG - Intergenic
1021637106 7:22704277-22704299 GCCACTCAGGGTGAAGGAGAAGG - Intergenic
1026428948 7:70324959-70324981 TCCTCTTCAGGAAAATGAGAGGG - Intronic
1027895880 7:84044299-84044321 GCCTCACCAGGGAAATGAAAAGG - Intronic
1028801486 7:94970413-94970435 GCCTCTCCCGGTAAGTGCAAGGG - Intronic
1032465656 7:132143042-132143064 GCCACTCAGGCTAAATGAGCAGG + Intronic
1033909696 7:146248246-146248268 GCCGCTCAGGGTGAAGGAGAAGG + Intronic
1034542372 7:151766710-151766732 GCCTTGACGGATAAATGAGAGGG - Intronic
1037666798 8:20976685-20976707 GCCTCTCCCAGTTACTGAGAGGG - Intergenic
1037922925 8:22820467-22820489 GCCTCTCCCGGTCAAGGGGAGGG - Intronic
1038078746 8:24107920-24107942 GCATCTCCAGGTAAAAGAGATGG + Intergenic
1041007266 8:53507801-53507823 GCTTCACCGGTAAAATGAGAGGG + Intergenic
1045223551 8:100222157-100222179 TCCTCTCCTGATAGATGAGAAGG - Intronic
1047415612 8:124662505-124662527 GGCTCTCCAGGTAATTGTGATGG - Intronic
1054793973 9:69281507-69281529 GACTCTGGGGGTAAATGAGCTGG - Intergenic
1055772441 9:79731633-79731655 GCCTCTCAAGGTAAATGCAAAGG - Intergenic
1187086739 X:16049449-16049471 GCCACTCAGGGTGAAGGAGAAGG + Intergenic
1187100077 X:16183333-16183355 GCCGCTAAGGGTAAAGGAGAAGG + Intergenic
1188143826 X:26585974-26585996 GCCTTTCCTGGTAACTAAGATGG - Intergenic
1200976317 Y:9215517-9215539 GCCTCTCCTGGTGAATCAGGTGG - Intergenic
1201581180 Y:15513274-15513296 GCCACTAAGGGTAAAGGAGAAGG - Intergenic
1202134852 Y:21651013-21651035 GCCTCTCCTGGTGAATCAGGTGG + Intergenic