ID: 1092980089

View in Genome Browser
Species Human (GRCh38)
Location 12:13786153-13786175
Sequence GTACCTGCTTAGTTTAGTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 34}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092980089_1092980091 26 Left 1092980089 12:13786153-13786175 CCTCGACTAAACTAAGCAGGTAC 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1092980091 12:13786202-13786224 CATCCATAGTTATTCAGCAAAGG 0: 1
1: 1
2: 1
3: 7
4: 118
1092980089_1092980092 27 Left 1092980089 12:13786153-13786175 CCTCGACTAAACTAAGCAGGTAC 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1092980092 12:13786203-13786225 ATCCATAGTTATTCAGCAAAGGG 0: 1
1: 0
2: 1
3: 17
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092980089 Original CRISPR GTACCTGCTTAGTTTAGTCG AGG (reversed) Intronic
906819048 1:48910207-48910229 TTACCTGCTTAATATAGTCAGGG - Intronic
912896106 1:113591655-113591677 GTACCTGCTTTGTATAATTGTGG - Intronic
920729409 1:208468761-208468783 ATACCTGCTTATTTTAGAAGTGG - Intergenic
921505470 1:215963567-215963589 GTGCCTGCATATTTTAGTGGAGG - Intronic
1072147506 10:92655466-92655488 GTACCTGCATAGTTTATTTTGGG - Intergenic
1092436632 12:8452429-8452451 GTGCCTGCTTAGTTCAATCATGG + Intergenic
1092980089 12:13786153-13786175 GTACCTGCTTAGTTTAGTCGAGG - Intronic
1096562067 12:52442866-52442888 GTAGATGCCTAGTTTAGGCGAGG + Intergenic
1100688712 12:97015081-97015103 TTACCTGCATACTTTAGTGGTGG - Intergenic
1144253983 17:13447331-13447353 GTACCTGCTTGGTGTACTCTTGG - Intergenic
1163256724 19:16160547-16160569 GTAGCTGCTTAATTTATTAGCGG + Intergenic
925722070 2:6839154-6839176 GTTCCAGCTAAGTTTAGTCCAGG + Intergenic
928462405 2:31486533-31486555 GTACCTGGATATTTTAGTTGAGG + Intergenic
938910988 2:135885850-135885872 GAACCAGCTTATTTTAGTCAAGG + Intergenic
1183104625 22:35607182-35607204 GTGTCTGCTTTGTTTAGTAGAGG - Exonic
1184207758 22:43015621-43015643 GGACCCGCTTAGTTTAAACGGGG + Intergenic
962048134 3:131783212-131783234 GTACTTGCTTATTATAGTGGAGG - Intronic
971063784 4:23003879-23003901 GTATCTGGTTAGTTTAATCAGGG - Intergenic
981359398 4:143829719-143829741 GTACCTGCTTGATTTAGGAGGGG + Intergenic
981370168 4:143950678-143950700 GTACCTGCTTGATTTAGGAGGGG + Intergenic
984426710 4:179596904-179596926 TTACCTGCTTATTTCAGTCCAGG - Intergenic
992738995 5:79754265-79754287 GTATCTGCTTAGTTTAGGTAGGG - Intronic
993817056 5:92562031-92562053 GTACCTCCTTATTTTGGTGGAGG - Intergenic
1006056531 6:31389408-31389430 CAACCTGCTGAGATTAGTCGAGG + Intergenic
1006069256 6:31486387-31486409 CAACCTGCTGAGATTAGTCGAGG + Intergenic
1021060163 7:16101355-16101377 CTTCCTGGTTAGTTTAGTCTTGG + Intronic
1021509164 7:21416623-21416645 TTACCTGCTTATTTTAGTTCAGG + Intergenic
1030832823 7:114247836-114247858 GTACCTGGGTATATTAGTCGGGG + Intronic
1034864030 7:154625266-154625288 ATAGCTGCTTAGTTTATTCTTGG - Intronic
1041457884 8:58079850-58079872 CTACCTGCATAGTTTATTAGTGG + Intronic
1045531751 8:102991623-102991645 GTACCTGATTGGTTTAGTGTGGG + Intergenic
1045951422 8:107855682-107855704 GTACCAGCTTAATATAGTAGTGG + Intergenic
1055495012 9:76845454-76845476 GTGCTTACTTAGTTTAGTTGAGG + Intronic
1188596407 X:31906751-31906773 GGAGCTGCTTAGTCTAGTCAAGG - Intronic
1191804885 X:65124691-65124713 ATACCTTCTTAGTTTAATCTAGG + Intergenic