ID: 1092980091

View in Genome Browser
Species Human (GRCh38)
Location 12:13786202-13786224
Sequence CATCCATAGTTATTCAGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 1, 2: 1, 3: 7, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092980090_1092980091 -9 Left 1092980090 12:13786188-13786210 CCTACTGCTTTAATCATCCATAG 0: 1
1: 0
2: 0
3: 10
4: 130
Right 1092980091 12:13786202-13786224 CATCCATAGTTATTCAGCAAAGG 0: 1
1: 1
2: 1
3: 7
4: 118
1092980089_1092980091 26 Left 1092980089 12:13786153-13786175 CCTCGACTAAACTAAGCAGGTAC 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1092980091 12:13786202-13786224 CATCCATAGTTATTCAGCAAAGG 0: 1
1: 1
2: 1
3: 7
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092980091 Original CRISPR CATCCATAGTTATTCAGCAA AGG Intronic
903056893 1:20642204-20642226 CCACCATTGTTATGCAGCAAAGG + Intronic
908436062 1:64107895-64107917 CAGCCATAAATATTCAGCATCGG + Intronic
909045821 1:70708102-70708124 CATGCATAGTTAGTAAGCAGCGG + Intergenic
910776054 1:90876266-90876288 CATACATAGATGTTCAGTAAGGG - Intergenic
919840086 1:201602688-201602710 CATCCAGAGTTCTTCAGCCTTGG + Intergenic
921423029 1:214970819-214970841 AATGCATAGTTATTAATCAAAGG - Intergenic
1063443763 10:6095050-6095072 CATCCATATTTCTTAAGGAATGG + Intronic
1063781357 10:9328816-9328838 CATTAATATTTATTCATCAATGG - Intergenic
1068851575 10:61748566-61748588 CATTCACAGTTCTGCAGCAAGGG - Intronic
1070381093 10:75881168-75881190 CATACATACATATTTAGCAATGG + Intronic
1071928191 10:90435731-90435753 CTTCCATAGTTATTGAAAAATGG + Intergenic
1072023831 10:91433406-91433428 CATACATAGTTACCCACCAAAGG - Intronic
1072379289 10:94850788-94850810 CATCCATGGTTATTTGGCAAAGG - Intronic
1072390997 10:94986907-94986929 CATCCATGGTCATTTGGCAAAGG - Intronic
1076252882 10:128997308-128997330 CATCCATAGGGACTCAGAAAAGG + Intergenic
1079677910 11:23254863-23254885 CATACATTATTTTTCAGCAATGG + Intergenic
1080123200 11:28701278-28701300 CCTCCCTAGCCATTCAGCAATGG + Intergenic
1080829165 11:35875451-35875473 AATCCATAGATAGACAGCAAGGG + Intergenic
1081299574 11:41434101-41434123 GGTCCATAGATATTCAGCAGTGG + Intronic
1087539455 11:99496801-99496823 AATCCATAGTTATTTATGAATGG - Intronic
1092980091 12:13786202-13786224 CATCCATAGTTATTCAGCAAAGG + Intronic
1095876389 12:47083503-47083525 CTTCCATAGTTGTTGGGCAAAGG - Intronic
1097505479 12:60463280-60463302 TCTCCATAATTATTCAGAAATGG - Intergenic
1098516748 12:71386403-71386425 CATCCTTAATTTTTCAGGAAGGG - Intronic
1099074302 12:78085903-78085925 CATCCAGACTCATTCAGCAGTGG + Intronic
1099295843 12:80826844-80826866 CATCAATAGATTTTAAGCAAGGG - Intronic
1103121318 12:118382020-118382042 AATCCATCTTTATTCAGCACTGG - Intronic
1106450548 13:29878002-29878024 CAACCATAATTATATAGCAAGGG + Intergenic
1112847224 13:103658856-103658878 CTTCCATGATTATTCAGCATTGG + Intergenic
1119367153 14:74103017-74103039 CATACAAAGTTACTCGGCAATGG - Intronic
1121469400 14:94140238-94140260 CTTCCCTAGTTGTTCAGCAGAGG - Intergenic
1122429324 14:101629941-101629963 CAGCCATACGTATTCAGCCAAGG + Intergenic
1128066117 15:64765642-64765664 CATCAATAGTTCTTCAAAAATGG + Intronic
1140861343 16:79020985-79021007 CACCCCAAGTTATTCAGCATGGG + Intronic
1141811286 16:86378020-86378042 CATCCGGAGTCATTCAGCAGCGG - Intergenic
1150037170 17:61815457-61815479 CAGACATAGTTATTCTGTAAAGG + Intronic
1150202506 17:63372021-63372043 CACGCATACTTATCCAGCAAAGG + Intronic
1151102114 17:71567916-71567938 CATGGAGAGTTATTCAGCTATGG - Intergenic
1203164072 17_GL000205v2_random:78037-78059 CATCCCTAGGTATTCTGCCAGGG + Intergenic
1159766190 18:72491476-72491498 CATCCATTATTATTCCACAAAGG + Intergenic
1164648506 19:29875727-29875749 CATTCATAGGTACTCAGCAGAGG + Intergenic
1165365112 19:35360402-35360424 GATCCACATTTATTGAGCAATGG - Exonic
1165366930 19:35372870-35372892 GATCCACATTTATTGAGCAATGG - Intronic
929640494 2:43573855-43573877 CATCTATAGTTATTTAGAATAGG - Intronic
930537621 2:52664001-52664023 CATCATTAGTCATTCAGAAAAGG + Intergenic
930881118 2:56271673-56271695 CATGGACAGTTGTTCAGCAACGG - Intronic
932588543 2:73048095-73048117 CATACATGGTTATATAGCAATGG - Intronic
935618074 2:105105763-105105785 CCTACAAAGTTATTGAGCAAAGG - Intergenic
940684080 2:156824283-156824305 CATCCATAGTCATTCAGTCAAGG - Intergenic
940961575 2:159792597-159792619 CTAACTTAGTTATTCAGCAATGG - Intronic
943330457 2:186552415-186552437 CATGCATATTTATTGAACAAGGG + Intergenic
944159821 2:196646411-196646433 CATTCACAGTACTTCAGCAAAGG + Exonic
948275046 2:236701805-236701827 AATCCCTTGTTATTAAGCAAAGG - Intergenic
1170545364 20:17431554-17431576 CATCCAAAGATTTTGAGCAAGGG + Intronic
1171083478 20:22213160-22213182 AATACATTTTTATTCAGCAAAGG + Intergenic
1172362345 20:34322060-34322082 CATCCATAGTGTTACAGGAAAGG - Intergenic
1173722697 20:45273331-45273353 CATCCCTAGTTATTGAGTACTGG - Intergenic
1174280373 20:49434771-49434793 AATCCATAGTTTTTGAACAAGGG - Intronic
1174514775 20:51083303-51083325 CATTCATGGTGTTTCAGCAAAGG + Intergenic
1175656062 20:60772214-60772236 CATTCATAGTTTTTCAGACATGG + Intergenic
1177369984 21:20189757-20189779 CAGCCATAATTATTAAGTAAAGG + Intergenic
1185138452 22:49087128-49087150 CATCCCTAGGTCCTCAGCAATGG + Intergenic
949807412 3:7970846-7970868 TTTCCTGAGTTATTCAGCAAGGG + Intergenic
954791014 3:53133465-53133487 CATCCAAGGTCATTCAGCAAAGG + Intergenic
956387799 3:68739177-68739199 CTTCCATTGTGATTCAGAAATGG - Exonic
957820654 3:85369820-85369842 CATCAATTTTTCTTCAGCAAAGG - Intronic
959824862 3:110781746-110781768 CTTCACTTGTTATTCAGCAAGGG - Intergenic
962700714 3:137997542-137997564 CATCCACAGCTAGTAAGCAATGG + Intergenic
965242692 3:166223979-166224001 TTTGCATAGTTATTCAGAAAGGG - Intergenic
969381587 4:6802559-6802581 CACACATAGTTATTTAGTAAGGG - Intronic
972646267 4:40970546-40970568 CATCCATTCTACTTCAGCAATGG + Intronic
976860598 4:89661388-89661410 CAACCAGGATTATTCAGCAAAGG + Intergenic
977716800 4:100191497-100191519 CTTCCAAAGTTATTAAGCCACGG + Intergenic
977876325 4:102154837-102154859 CATCCCTTGTGATTGAGCAATGG - Intergenic
982018885 4:151183680-151183702 CATTCATAGTTCTATAGCAAGGG - Intronic
982400037 4:154956028-154956050 CATCCGTAGTTAATCAACATAGG + Intergenic
983672136 4:170250034-170250056 TATCAATATTTATTCGGCAAAGG + Intergenic
985376155 4:189341059-189341081 CATCCACAGTCATGCAGCAATGG - Intergenic
985385234 4:189439435-189439457 CACCCATAGTCATTCAGGGAGGG + Intergenic
986943135 5:12981159-12981181 CATTCATTTTTATTCAACAAAGG - Intergenic
988708659 5:33751853-33751875 GATCCATAGATATCCAGCAATGG - Intronic
989065147 5:37452866-37452888 CCCCCATAGCTATTCAGGAAGGG + Intronic
989459782 5:41683954-41683976 CATCAGTAGTTATTCATTAATGG + Intergenic
993251736 5:85534733-85534755 CATCCATAGTTATTCATCACAGG + Intergenic
993704620 5:91155499-91155521 TATTCATAGTCATTCCGCAATGG + Intronic
994418959 5:99508687-99508709 CCCCCATAGCTATTCAGGAAGGG + Intergenic
995035534 5:107530170-107530192 CATCCACTGTAAGTCAGCAAGGG + Intronic
995175400 5:109170683-109170705 AACCCACAGTTACTCAGCAAAGG + Intronic
996479035 5:123952367-123952389 AGTCTATAGTTATTCAGAAAGGG - Intergenic
999841244 5:155429894-155429916 TTTCCATAGTAATTTAGCAAGGG + Intergenic
1001349805 5:170949483-170949505 CATCCTTAGTTATTAAGGAAAGG + Intronic
1005023613 6:21441512-21441534 CATTCATATTCATTCAGGAACGG - Intergenic
1005497848 6:26404431-26404453 CATAAATAGTTATGCAGAAATGG + Intronic
1008199738 6:48571584-48571606 CATACATAGTTTTTCAGCCGAGG - Intergenic
1009306795 6:62101282-62101304 CATCCACAGTTTTGCAGCAGTGG + Intronic
1011736329 6:90314040-90314062 CATTCATAGTTTTTGAGCACGGG + Intergenic
1012530909 6:100235240-100235262 CATCCAGAGCTACTCAGCTACGG + Intergenic
1016389751 6:143562733-143562755 CATCCACAGTTATTCCTAAAAGG + Intronic
1018094059 6:160369269-160369291 AATCCATAGTTATTCTAAAATGG + Intronic
1023813937 7:43934250-43934272 CATGAATACTTATTCTGCAAAGG - Intronic
1023912409 7:44565422-44565444 CATCAACAGTTGTTCAGAAAGGG + Exonic
1030522144 7:110611113-110611135 CATCAATAGTTATTAGGTAAAGG + Intergenic
1030779524 7:113582506-113582528 CAGCCATAATTATTCAGCATGGG + Intergenic
1035352036 7:158253834-158253856 CATCCATATTTATCGAGCAGAGG + Intronic
1039384464 8:37120923-37120945 CATAAATAGATAGTCAGCAAAGG + Intergenic
1039464276 8:37772550-37772572 CATCCCTGGCTAATCAGCAAAGG - Intronic
1039954425 8:42196133-42196155 CACCCCTAGTTATCCAGAAAGGG - Intronic
1042334350 8:67614507-67614529 CTTCCTCAGTTATTCAGCAGCGG - Intronic
1042424286 8:68628669-68628691 CCTTCACAGTGATTCAGCAATGG - Intronic
1045119868 8:99025285-99025307 CAGCCAGAGTAATTAAGCAAGGG - Intronic
1045676453 8:104613715-104613737 CTGTAATAGTTATTCAGCAAAGG - Intronic
1048653777 8:136512158-136512180 CAGCAATAGATATTCAGGAATGG + Intergenic
1054958716 9:70943053-70943075 CTGCCACAGTTATTAAGCAATGG - Intronic
1055845096 9:80552644-80552666 AATCCACAGTGATTCTGCAAGGG - Intergenic
1059938408 9:119334458-119334480 CAGCCATAGGAATTCAACAAGGG + Intronic
1187052264 X:15706670-15706692 CATCTATAGTTATTCAGCAAGGG + Intronic
1187090070 X:16087052-16087074 CATCCATATTTATACTGCACTGG + Intergenic
1187136557 X:16552749-16552771 CATCCAGAATTACTCAACAATGG - Intergenic
1188282787 X:28290749-28290771 CTTCCATAGTTATGCAGAACTGG - Intergenic
1188991581 X:36827312-36827334 CATCTAAAGTTATGCAGCATTGG + Intergenic
1193673026 X:84413177-84413199 CCTCAATAGTTCTCCAGCAATGG - Intronic
1198080699 X:133236561-133236583 CAGCCATAGTTATAAACCAATGG + Intergenic
1199859866 X:151791732-151791754 CATACGTAGTTTATCAGCAAGGG - Intergenic
1201050135 Y:9924427-9924449 CATCACTAGTGATTCAGCATGGG + Intergenic
1202163173 Y:21956595-21956617 CATCACTAGTGATTCAGCATGGG + Intergenic
1202228183 Y:22629773-22629795 CATCACTAGTGATTCAGCATGGG - Intergenic
1202314974 Y:23566403-23566425 CATCACTAGTGATTCAGCATGGG + Intergenic
1202555827 Y:26104190-26104212 CATCACTAGTGATTCAGCATGGG - Intergenic