ID: 1092980092

View in Genome Browser
Species Human (GRCh38)
Location 12:13786203-13786225
Sequence ATCCATAGTTATTCAGCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092980089_1092980092 27 Left 1092980089 12:13786153-13786175 CCTCGACTAAACTAAGCAGGTAC 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1092980092 12:13786203-13786225 ATCCATAGTTATTCAGCAAAGGG 0: 1
1: 0
2: 1
3: 17
4: 146
1092980090_1092980092 -8 Left 1092980090 12:13786188-13786210 CCTACTGCTTTAATCATCCATAG 0: 1
1: 0
2: 0
3: 10
4: 130
Right 1092980092 12:13786203-13786225 ATCCATAGTTATTCAGCAAAGGG 0: 1
1: 0
2: 1
3: 17
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092980092 Original CRISPR ATCCATAGTTATTCAGCAAA GGG Intronic
902887765 1:19418558-19418580 ATTCATAGTAATTCAGGAAGTGG - Intronic
903056894 1:20642205-20642227 CACCATTGTTATGCAGCAAAGGG + Intronic
904202777 1:28832251-28832273 ATCCATTGTTAATAAACAAAAGG + Intronic
909090730 1:71221713-71221735 TTCCATAGCTATTAAACAAATGG + Intergenic
909629651 1:77758791-77758813 CCACATAGTTATTAAGCAAAAGG + Intronic
911016384 1:93337527-93337549 ATGAATAGTTGTTCAGTAAATGG - Intergenic
911403166 1:97401866-97401888 ATACATAGTAATTTACCAAATGG - Intronic
916798888 1:168195535-168195557 ATAGGTATTTATTCAGCAAATGG + Intronic
917145141 1:171882361-171882383 ATTCATAGTTGTTATGCAAAAGG - Intronic
917806883 1:178621894-178621916 CCCCAAAGATATTCAGCAAATGG - Intergenic
920407362 1:205726694-205726716 AACCAAAGTTATCCAGCAAATGG - Intronic
1064268628 10:13845972-13845994 ATTCAGAGTTGTACAGCAAATGG - Intronic
1067304536 10:45049039-45049061 ATCCAAAACTACTCAGCAAATGG - Intergenic
1067959809 10:50835517-50835539 TTTGATAGTTATTCACCAAATGG + Intronic
1068375453 10:56173043-56173065 AACCAAAATTATTCAGCATATGG + Intergenic
1072187178 10:93050970-93050992 ATACATAGTTAATAATCAAATGG - Intronic
1072499176 10:95995007-95995029 ATTCACAGGTATTCAGAAAAAGG - Intronic
1074067872 10:110035070-110035092 ATTTTTATTTATTCAGCAAATGG - Intronic
1078656431 11:13244934-13244956 ATCCACAGTCATACAGCAAGTGG + Intergenic
1080829166 11:35875452-35875474 ATCCATAGATAGACAGCAAGGGG + Intergenic
1080987309 11:37484219-37484241 GTTCATAGTTCTTCAGCATAGGG + Intergenic
1091853603 12:3720984-3721006 ATCCATAATAATTCAACAAGTGG - Intronic
1092980092 12:13786203-13786225 ATCCATAGTTATTCAGCAAAGGG + Intronic
1093625445 12:21341302-21341324 ATCTATAGTTATCCAGAAAGTGG + Intronic
1095223516 12:39649832-39649854 ATCTAAAGTTACTCAGTAAATGG + Intronic
1100045410 12:90374552-90374574 CACCATTGTTATTCAGCATAGGG - Intergenic
1101212914 12:102552440-102552462 ATCCTTAGTTAATCAGAGAAAGG + Intergenic
1103234234 12:119358926-119358948 ATCTACATTTATTCACCAAAAGG - Intronic
1105399594 13:20077610-20077632 ATAGAAATTTATTCAGCAAAGGG + Intronic
1107575700 13:41719304-41719326 ACGCATAGTAATTCAACAAAAGG + Intronic
1108354825 13:49620621-49620643 AGAAATATTTATTCAGCAAATGG - Intergenic
1108923774 13:55711479-55711501 ATGGAGAGTTATTCATCAAAGGG - Intergenic
1109438420 13:62337266-62337288 ATCCATAGATAATTGGCAAATGG + Intergenic
1110113107 13:71776046-71776068 ATCAAAAGTTATTCAGTAAAAGG + Intronic
1111331792 13:86767564-86767586 ATGCATAGTTGTTCTGAAAAAGG + Intergenic
1112681838 13:101775796-101775818 ATTAATAGTTATTGAGCCAAGGG + Intronic
1123916439 15:25033501-25033523 GTCCATAGTTCATAAGCAAAGGG + Intergenic
1125147476 15:36488795-36488817 ACTCATAGTTATGCAGCAGAAGG - Intergenic
1126375186 15:47990516-47990538 ATCCATAGTTATTTGGCAACAGG + Intergenic
1127713246 15:61622400-61622422 TTCAAGAGTTATTTAGCAAATGG + Intergenic
1130606162 15:85318921-85318943 ACCCAAAGTTATGCAGCAGATGG - Intergenic
1135520281 16:23171567-23171589 ATCAGTAGGTATTCTGCAAAAGG - Intergenic
1138235770 16:55381201-55381223 GTCCAAAGTTATTCAGAAAGTGG + Intergenic
1138994406 16:62431674-62431696 ATCATTAGTTATACAGCATATGG + Intergenic
1144366309 17:14548095-14548117 ACCTATAGATATTCAGCAAAAGG - Intergenic
1145194224 17:20873652-20873674 ATCCATAGATCTTCAGTAAAAGG - Intronic
1145297816 17:21607502-21607524 AGCCATAGATCTTCAGTAAAAGG + Intergenic
1150202507 17:63372022-63372044 ACGCATACTTATCCAGCAAAGGG + Intronic
1150486459 17:65547065-65547087 ATCCAAAGTGCTTCAGCTAAAGG + Intronic
1153005164 18:491519-491541 ATTCATATTTATTAAGCAGATGG - Intronic
1154396507 18:13995439-13995461 ATCCTTGGTTGTTCAGAAAAAGG + Intergenic
1157535545 18:48454705-48454727 AACCATTGCTATTCAGCAAAAGG + Intergenic
1159549881 18:69883934-69883956 ATCCAAAGCAAATCAGCAAAGGG + Intronic
1164648507 19:29875728-29875750 ATTCATAGGTACTCAGCAGAGGG + Intergenic
1165365111 19:35360401-35360423 ATCCACATTTATTGAGCAATGGG - Exonic
1165366929 19:35372869-35372891 ATCCACATTTATTGAGCAATGGG - Intronic
928037620 2:27839937-27839959 ATTCATAATCAATCAGCAAATGG - Intronic
928409295 2:31042145-31042167 ATCCATAGTCATCCAGCAAAAGG + Intronic
929640493 2:43573854-43573876 ATCTATAGTTATTTAGAATAGGG - Intronic
930157571 2:48120993-48121015 ATCCATCATGAGTCAGCAAATGG - Intergenic
931982384 2:67707727-67707749 ATCCAGACTCATCCAGCAAATGG - Intergenic
932037817 2:68265122-68265144 TCCCATAGTTATGCACCAAATGG - Intergenic
935943023 2:108261391-108261413 ATGCATAGTTATTAAGAGAATGG - Intronic
936272101 2:111056829-111056851 CTCCATAGTAAGTCAGCAAAAGG + Intronic
938730728 2:134145008-134145030 TTCCACAAGTATTCAGCAAATGG - Intronic
939779328 2:146425446-146425468 ATCCATAGATATTTACCAAGAGG + Intergenic
941222249 2:162797256-162797278 ATCCAGAGATATTAAACAAATGG - Intronic
941269026 2:163402189-163402211 GTTCTTTGTTATTCAGCAAAGGG - Intergenic
942916777 2:181318777-181318799 CTCCATTGTTATTGAACAAATGG + Intergenic
946608047 2:221427502-221427524 CTCTATGGTTATTCAGCAATTGG - Intronic
946826504 2:223684193-223684215 GTCCAGAGTCATTGAGCAAAGGG - Intergenic
1171083479 20:22213161-22213183 ATACATTTTTATTCAGCAAAGGG + Intergenic
1172362344 20:34322059-34322081 ATCCATAGTGTTACAGGAAAGGG - Intergenic
1174514776 20:51083304-51083326 ATTCATGGTGTTTCAGCAAAGGG + Intergenic
1176278660 20:64288371-64288393 ATCCATAGGCACTCAGTAAAAGG - Intergenic
1177725491 21:24961522-24961544 AACTTTGGTTATTCAGCAAAGGG + Intergenic
949807413 3:7970847-7970869 TTCCTGAGTTATTCAGCAAGGGG + Intergenic
950937707 3:16858474-16858496 AACCTAAGTTATTCAGCAAAAGG - Intronic
950986642 3:17377519-17377541 ATCCCTAGTTACTAAGCAAAAGG - Intronic
951132507 3:19064495-19064517 ATCCTTGGTTATTCAATAAAGGG + Intergenic
951429460 3:22589325-22589347 ATCCATGGATATTCTGCAATAGG + Intergenic
955900594 3:63749617-63749639 ATGCATACAAATTCAGCAAAAGG + Intergenic
956464680 3:69507238-69507260 ATCCAGAGTTATTCAGTGAAAGG + Intronic
957369736 3:79277818-79277840 ACCCAGAGTTATTAACCAAAAGG + Intronic
957456557 3:80457914-80457936 ATTCATACTTATTCAGCACCAGG + Intergenic
957527383 3:81394607-81394629 TTCTATAGCTAATCAGCAAAAGG - Intergenic
957749611 3:84396273-84396295 CTCCCTAGATATACAGCAAAGGG + Intergenic
957820653 3:85369819-85369841 ATCAATTTTTCTTCAGCAAAGGG - Intronic
957919255 3:86727694-86727716 ATCTATATTTATTAAGAAAAAGG + Intergenic
960505694 3:118490599-118490621 TTGCATATATATTCAGCAAAGGG - Intergenic
961331094 3:126138842-126138864 TTCCATAGTTATTTAGATAAGGG - Intronic
962019537 3:131483461-131483483 AGCAATAGTTTTTCATCAAAAGG - Intronic
964025415 3:152067849-152067871 AACTATAGTTATTCAGTTAATGG - Intergenic
966147188 3:176825103-176825125 ATGCATATTTATTCAGCACATGG + Intergenic
966162315 3:176981523-176981545 ATTCCTTGTTATTCAGTAAATGG + Intergenic
968016244 3:195336611-195336633 ATTTTTAGTTATTCACCAAATGG + Intronic
971413945 4:26405495-26405517 CTACATATTTATTGAGCAAATGG - Intronic
975192154 4:71477603-71477625 ATACATAGTCATTAAGAAAAAGG + Intronic
975390606 4:73812845-73812867 ATCCATAGTTCCTGATCAAATGG - Intergenic
975445978 4:74466133-74466155 ATCCTTAGGTATTAAGGAAAAGG + Intergenic
977126581 4:93176080-93176102 ATCAACAGTTAATAAGCAAATGG + Intronic
977145572 4:93435775-93435797 ATCCATAGTTGTTAAGAGAATGG - Intronic
977383342 4:96306038-96306060 AGCCATAATAATTCAGCAAGTGG + Intergenic
980135541 4:128855370-128855392 ATACATATTTATTTAGCAGAGGG - Intronic
980606775 4:135102238-135102260 AACCTGAGTTATTCAACAAAAGG - Intergenic
983434624 4:167696897-167696919 ATCCATATTTATGCACAAAAAGG - Intergenic
983971424 4:173879810-173879832 ATCCTTAGAAATTCAGTAAAAGG + Intergenic
984957912 4:185064015-185064037 CTCCCTAGTGATACAGCAAAAGG + Intergenic
986182086 5:5402563-5402585 ATCCATAATTATTCAACTGAAGG - Intergenic
988051229 5:26033511-26033533 TTCCATAGTTATTCACTACATGG + Intergenic
988708658 5:33751852-33751874 ATCCATAGATATCCAGCAATGGG - Intronic
990607756 5:57427610-57427632 ATCCATATACACTCAGCAAATGG + Intergenic
991553785 5:67872737-67872759 TTCCATAGCTGTACAGCAAAGGG - Intergenic
993704621 5:91155500-91155522 ATTCATAGTCATTCCGCAATGGG + Intronic
995296434 5:110529705-110529727 AGCAATATTTATTCAGGAAAAGG + Intronic
995538203 5:113158558-113158580 ACCAATAAATATTCAGCAAACGG - Intronic
996476110 5:123922868-123922890 ATGAATAGTTTTTCAACAAATGG - Intergenic
996999746 5:129745679-129745701 ATCATTATTTATTGAGCAAAGGG + Intergenic
997300662 5:132801682-132801704 ATCAATAGTTATTGAACATAAGG + Intronic
999632145 5:153582314-153582336 ATCCCTAGAAAGTCAGCAAATGG + Intronic
1000297259 5:159922746-159922768 ATACATATTTATTCAGTGAATGG - Intronic
1000720159 5:164695796-164695818 ACCCAGAGTTATTCAGCAGCAGG - Intergenic
1001035907 5:168296043-168296065 ACCCAGAGTTACTCCGCAAAAGG - Intronic
1004827073 6:19434370-19434392 ATCCAAACTTATTCTTCAAAAGG + Intergenic
1006245573 6:32731531-32731553 ATCCATACCTATTCAGAATAGGG - Intergenic
1010726428 6:79338982-79339004 AACCAAAGTTATACAGCTAAAGG + Intergenic
1014490895 6:122060591-122060613 ATCCATAGTTTTTTAAAAAAAGG + Intergenic
1014649084 6:124013064-124013086 ATCGTTAGTTATTAAGGAAATGG - Intronic
1015193250 6:130495367-130495389 AAAGATAGTTTTTCAGCAAATGG - Intergenic
1017477112 6:154808180-154808202 TTCCATAGATATTCAGCAACAGG + Exonic
1019984667 7:4646946-4646968 ATACATAATTATTCAACATATGG + Intergenic
1020531961 7:9349647-9349669 AAGCATTGTTATTCAGCAAATGG - Intergenic
1020939335 7:14510704-14510726 ATAGATAGTGATTCATCAAATGG - Intronic
1021506575 7:21391926-21391948 ATCTACAGTTATACAGCACACGG - Intergenic
1023494718 7:40782917-40782939 AATCATAGTAACTCAGCAAAAGG - Intronic
1024084632 7:45883165-45883187 ATTCATAGTTCTTTATCAAATGG + Intergenic
1024834897 7:53505228-53505250 ATCAATAATTATTAAGCAACAGG - Intergenic
1027548868 7:79565464-79565486 AGCCAGAGTGATTCAGCAAATGG - Intergenic
1027699195 7:81448572-81448594 TTCCAGAGTTATACAGCAAGTGG - Intergenic
1029418259 7:100457053-100457075 ACCCATAGATAAACAGCAAAGGG + Intronic
1030468448 7:109932446-109932468 ATCTATAGTTATTCAGCATTAGG + Intergenic
1032185094 7:129717921-129717943 ATCCATGTTTAAGCAGCAAATGG + Intronic
1032207040 7:129875201-129875223 ATCCATAGCTGTTCAGTTAAAGG - Intronic
1033648767 7:143324026-143324048 ACCTATATTTTTTCAGCAAAGGG + Intronic
1037697349 8:21236144-21236166 TTCCACAGTTACACAGCAAAGGG + Intergenic
1042977265 8:74483323-74483345 AACCATAGTTTTTCAGAATAAGG + Intronic
1044017452 8:87061362-87061384 TTCCATAATAATACAGCAAATGG + Intronic
1048852878 8:138661432-138661454 ATCCATACTCATTGACCAAATGG - Intronic
1049880850 8:145061712-145061734 ATCCTGATTTATGCAGCAAAAGG + Intergenic
1050781347 9:9340515-9340537 ATCCAAAGTTGTTCAGTTAATGG + Intronic
1052013172 9:23434951-23434973 ATGAATACTTATTCAACAAATGG - Intergenic
1055572954 9:77634944-77634966 ATCCACAGTTATTCAGACATTGG + Intronic
1055845095 9:80552643-80552665 ATCCACAGTGATTCTGCAAGGGG - Intergenic
1059947118 9:119420776-119420798 GGCCATAGTTTTGCAGCAAATGG + Intergenic
1062642149 9:137524563-137524585 ATCCCTAGGTATTTAGCAAGAGG - Intronic
1186762555 X:12738457-12738479 ATCTATAGTAACTCTGCAAAAGG + Intergenic
1188351212 X:29133243-29133265 ATCATTATTTATTCAGTAAATGG + Intronic
1194113017 X:89859736-89859758 AATAATAGTCATTCAGCAAATGG - Intergenic
1196089461 X:111724487-111724509 GTCCATAGTGGGTCAGCAAATGG + Intronic
1198862057 X:141081606-141081628 ATACAGAGTTATTTAGTAAATGG + Intergenic
1198900633 X:141505766-141505788 ATACAGAGTTATTTAGTAAATGG - Intergenic
1199244912 X:145592545-145592567 ATCAATGGTCATTTAGCAAAGGG + Intergenic
1199525414 X:148786159-148786181 TTCCATATTTATTGAGTAAAAGG - Intronic
1200465669 Y:3514566-3514588 AATAATAGTCATTCAGCAAATGG - Intergenic
1201180704 Y:11341639-11341661 ATCCCTAGTTATTAAACACAAGG - Intergenic