ID: 1092980374

View in Genome Browser
Species Human (GRCh38)
Location 12:13788729-13788751
Sequence CCTCAGCAAAACAATCATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 262}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092980374_1092980381 22 Left 1092980374 12:13788729-13788751 CCAAAATGATTGTTTTGCTGAGG 0: 1
1: 0
2: 0
3: 24
4: 262
Right 1092980381 12:13788774-13788796 AGCATCTCCCTTTGAACTCTGGG 0: 1
1: 0
2: 1
3: 13
4: 187
1092980374_1092980380 21 Left 1092980374 12:13788729-13788751 CCAAAATGATTGTTTTGCTGAGG 0: 1
1: 0
2: 0
3: 24
4: 262
Right 1092980380 12:13788773-13788795 AAGCATCTCCCTTTGAACTCTGG 0: 1
1: 0
2: 2
3: 17
4: 171
1092980374_1092980382 23 Left 1092980374 12:13788729-13788751 CCAAAATGATTGTTTTGCTGAGG 0: 1
1: 0
2: 0
3: 24
4: 262
Right 1092980382 12:13788775-13788797 GCATCTCCCTTTGAACTCTGGGG 0: 1
1: 0
2: 3
3: 12
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092980374 Original CRISPR CCTCAGCAAAACAATCATTT TGG (reversed) Intronic
909036175 1:70596382-70596404 CCTGAGAAAAACAAGCATTGGGG - Intergenic
909784403 1:79593110-79593132 CCTCAGCAATAATAACATTTTGG + Intergenic
910748502 1:90600726-90600748 CCTGACCAAAACAAGCAATTGGG + Intergenic
911033534 1:93514644-93514666 CCTGAGAAAAACAAGCATTGGGG + Intronic
912436669 1:109666961-109666983 CCTCAGCAGTACTGTCATTTTGG + Intronic
915042244 1:152978378-152978400 CCTAAGCATAAGAATCACTTAGG - Intergenic
916652213 1:166842887-166842909 CCTCAGCACAACTGACATTTTGG - Intronic
917185601 1:172351478-172351500 CCTCAGCAAAGCAATTTTTAAGG - Intronic
919171830 1:193964240-193964262 CCTCACCTAAATGATCATTTAGG + Intergenic
921556590 1:216605721-216605743 CCTCAGAAAGCAAATCATTTTGG - Intronic
923334604 1:232956746-232956768 TCACAGCACAACAAACATTTAGG + Intronic
924208558 1:241741294-241741316 CCACAGAAAAGCATTCATTTTGG - Intronic
924391736 1:243567699-243567721 GCTCAGCAAAACAACGTTTTAGG - Intronic
1063779901 10:9310274-9310296 GCTCAGCAAAAAAATAATTATGG + Intergenic
1064052013 10:12067590-12067612 CCACAGAAAAAAAATCATTTGGG + Intergenic
1067197195 10:44132344-44132366 CCTCAGGAGAACAATCAATGAGG + Intergenic
1068731370 10:60362402-60362424 GCTCAGCATAACAATCAGTGCGG - Intronic
1069885996 10:71624006-71624028 CCTCTGGAAAACAATGAGTTGGG + Intronic
1070730879 10:78827420-78827442 CAGCTGGAAAACAATCATTTCGG + Intergenic
1071076235 10:81756587-81756609 ACTCTGCAAAATAATCATCTGGG - Intergenic
1071898862 10:90096197-90096219 CCTCAGCAAAACTATTAAATAGG - Intergenic
1073725276 10:106223115-106223137 CCTCAGAAAAACAAGCAATGGGG + Intergenic
1073742652 10:106426209-106426231 CTTTAGCAAGACAATCAGTTTGG - Intergenic
1074785055 10:116831759-116831781 CCTCAGCAACTAAATCATTGTGG - Intergenic
1075538876 10:123295576-123295598 CCTCAGCACTACAGACATTTTGG + Intergenic
1077476114 11:2791389-2791411 CCTCAGAAAAACATGTATTTTGG + Intronic
1077545555 11:3167981-3168003 CCTCAGCATGACCAGCATTTGGG - Intergenic
1079427160 11:20354579-20354601 CCTTAGTAAAACAAGCGTTTTGG + Intergenic
1081311308 11:41576957-41576979 CATCAGCAAAACAAACATCTGGG - Intergenic
1081511366 11:43776870-43776892 CCTGAGAAAAACAAGCATTGGGG - Intronic
1086298600 11:85399657-85399679 CCTGAGAAAAACAATCAATGGGG + Intronic
1088136112 11:106557240-106557262 CAGAAGCAAATCAATCATTTTGG + Intergenic
1089284606 11:117397365-117397387 AGTCAGCAAAACAGTCCTTTGGG + Intronic
1090451345 11:126809145-126809167 CTTCAGCAAAACCTTCATTAAGG + Intronic
1090701864 11:129303492-129303514 CCTCAGCTAAAAGATTATTTAGG + Intergenic
1090878946 11:130816255-130816277 ACTGAGGAAAACAAACATTTTGG + Intergenic
1091905367 12:4182016-4182038 ATTCAGCAGAAAAATCATTTGGG - Intergenic
1092028653 12:5264681-5264703 CCTGAGGAAAACAATAAATTGGG - Intergenic
1092919992 12:13222531-13222553 CCTCAGCAGAGCTATCACTTTGG - Intergenic
1092980374 12:13788729-13788751 CCTCAGCAAAACAATCATTTTGG - Intronic
1093669743 12:21859336-21859358 ACTCAGAAAAACAACCACTTAGG + Intronic
1093853402 12:24068627-24068649 CCTCAGCAAAACAACTCTTAAGG + Intergenic
1093896537 12:24581195-24581217 CCTGAGAAAAACAAGCATTGGGG + Intergenic
1094786429 12:33852867-33852889 CCTGAGAAAAACAAGCATTGGGG + Intergenic
1094822599 12:34238153-34238175 TCTCAGCAAAACAGTGGTTTAGG + Intergenic
1095182920 12:39166660-39166682 CCCCAGAAACACAATGATTTGGG + Intergenic
1096014507 12:48257241-48257263 CCTCAGCAAAAAATTCTTTTGGG + Intergenic
1096967980 12:55643779-55643801 CTCCAGCAAATCAATCTTTTTGG + Intergenic
1097951268 12:65431181-65431203 CCTCAGGAATACAGTCATTTAGG - Intronic
1099166218 12:79310281-79310303 CCTCAGAAAAAGAAGCAATTGGG - Intronic
1099973300 12:89523009-89523031 CCTGAGCAAAAAAATTATGTGGG - Exonic
1100063604 12:90612015-90612037 CCTCAGTGAAATAATCATTATGG - Intergenic
1101188731 12:102309042-102309064 CCTCAGAAAAACAAGCAATGGGG - Intergenic
1101239982 12:102828443-102828465 CCTCAGAAAAACAAGCAATGGGG - Intergenic
1103845366 12:123898467-123898489 CTTCAGAAATACATTCATTTTGG + Intronic
1105335682 13:19465858-19465880 CCTCAGCATTACCAACATTTTGG - Intronic
1106248125 13:27965759-27965781 CTTCAGTAAAACAATCAATCTGG - Intronic
1106490225 13:30214649-30214671 CCTCAGAAAAACAAGCAATGGGG + Intronic
1106494629 13:30264102-30264124 CCTCAGAAAAACAAGCAATGGGG + Intronic
1106761138 13:32868962-32868984 CCTGAGAAAAACAAGCAATTGGG - Intergenic
1107371772 13:39758349-39758371 TCTCTGCAAAATAATAATTTTGG + Intronic
1108630906 13:52281285-52281307 CCTCAGCATTACTAACATTTTGG - Intergenic
1108655781 13:52531281-52531303 CCTCAGCATTACTAACATTTTGG + Intergenic
1109696925 13:65972732-65972754 GCTCAGCAAGACCAGCATTTTGG + Intergenic
1110327735 13:74237206-74237228 CCTCAGAAAAACAAGCAATGGGG - Intergenic
1110353721 13:74541091-74541113 CCTCAGAAAAACAAGCAATGGGG + Intergenic
1110716751 13:78714412-78714434 CCTCAGCTAGATATTCATTTAGG + Intergenic
1111872001 13:93844909-93844931 CCTCAGAAAAACAAGCAATGGGG - Intronic
1112614683 13:100991477-100991499 TCTCAGAAAAACAATCACTAAGG + Intergenic
1112686517 13:101834633-101834655 TCTCAACAGGACAATCATTTGGG + Intronic
1114147630 14:19995336-19995358 CCTCAGGAAAACAGTCATGGTGG + Intergenic
1115277616 14:31625369-31625391 CCTTAGGAAATCAATCATTTGGG + Intronic
1115708389 14:36022447-36022469 GCTCAGCAAAATAGACATTTAGG - Intergenic
1116001931 14:39252695-39252717 CCTCAACAAAGCAAGTATTTTGG + Intronic
1116202519 14:41816481-41816503 CCTCAGACAAACAAACATTGAGG - Intronic
1117409148 14:55434567-55434589 CCTCAGCACACCTCTCATTTTGG - Intronic
1117888372 14:60389843-60389865 CCTTTGCAAAAAAATCATTAGGG - Intergenic
1118307947 14:64671022-64671044 CCTTAGTGAAAGAATCATTTGGG + Intergenic
1120902608 14:89588836-89588858 CCTCTGAAAAACAATGATTTTGG + Intronic
1122912462 14:104838214-104838236 CCTGAGAAAAACAAGCATTGGGG - Intergenic
1123964934 15:25445470-25445492 CCTAAGCAATACATTCATGTGGG - Intergenic
1124199797 15:27669204-27669226 CCTCAGTGAAATTATCATTTTGG - Intergenic
1125236549 15:37521014-37521036 CCTGAGCTAAACTATCATCTTGG - Intergenic
1126418038 15:48439400-48439422 TCTCAGCAAAGCAAACATTTGGG - Intronic
1126839591 15:52704232-52704254 CCTGAGAAAAACAAGCATTGGGG + Intronic
1129123083 15:73414875-73414897 CCACAGCAAATCATTCATGTGGG + Intergenic
1129939941 15:79487051-79487073 CCTGAGAAAAACAAGCATTGGGG - Intergenic
1129967130 15:79746352-79746374 CCTGAGAAAAACAAGCATTGGGG - Intergenic
1130771903 15:86932739-86932761 CTTCAGCAAAACATTCATAATGG - Intronic
1131272589 15:90956300-90956322 CCTCTGTAAAACGACCATTTTGG + Intronic
1134184288 16:12071434-12071456 CCTGAGAAAAACAAGCATTGGGG - Intronic
1138772426 16:59681715-59681737 CCTGAGAAAAACAAGCATTGGGG - Intergenic
1139386516 16:66575984-66576006 CCTTAGCAAAACAATAATGGAGG - Intronic
1139872068 16:70115550-70115572 CCTCAGCAAAAGAACCACCTGGG - Intronic
1140363851 16:74366924-74366946 CCTCAGCAAAAGAACCACCTGGG + Intergenic
1140609914 16:76585752-76585774 CCTCAGCCAAACAACCCTTGAGG - Intronic
1141059171 16:80849231-80849253 CCTCAGCATGATAAACATTTGGG - Intergenic
1143876415 17:9994407-9994429 CCTGAGAAAAACAAGCATTGGGG + Intronic
1150073263 17:62170622-62170644 CCTCAGAAAAGCATTTATTTTGG + Intergenic
1150780063 17:68114636-68114658 CCTCAGTAATACAAACATTAGGG - Intergenic
1151285732 17:73109712-73109734 GCTCAGCAAAACCTTCGTTTAGG + Intergenic
1152399023 17:80053023-80053045 CCTCAAGATATCAATCATTTGGG - Intronic
1153204754 18:2686138-2686160 GCTCAGCAAAACTATCTTTGGGG - Intronic
1153384150 18:4473410-4473432 CCTGAGAAAAACAAGCATTGGGG - Intergenic
1153494359 18:5682557-5682579 CCTGAGAAAAACAAGCATTAGGG - Intergenic
1154041599 18:10861082-10861104 CATCAGCAGAAGAATCACTTTGG - Intronic
1156053787 18:32972283-32972305 CCTCAGAAAAACAAGCAATGGGG - Intronic
1156590654 18:38484146-38484168 CCTCAGAAAAAAAATCAAGTGGG + Intergenic
1156848578 18:41699034-41699056 CATCTGGAAAACAATCAGTTGGG - Intergenic
1157641629 18:49220631-49220653 CCTGAGAAAAACAATCAATGGGG + Intronic
1158043389 18:53125213-53125235 CCTCATGAAAACTATTATTTCGG - Intronic
1158443072 18:57494499-57494521 GATCTGCACAACAATCATTTAGG + Intergenic
1158842795 18:61406151-61406173 CCTTTTCAAAACAAGCATTTGGG + Intronic
1159133074 18:64303425-64303447 CCTCAGCAATACAGTGAGTTAGG + Intergenic
1160247554 18:77171013-77171035 ACTCAGCAAAGCAATAAATTGGG - Intergenic
1164347266 19:27281820-27281842 CCTCAGAAAAACAAGCAATGGGG - Intergenic
1164348225 19:27295547-27295569 CCTCAGAAAAACAAGCAATGGGG - Intergenic
1167512111 19:49900881-49900903 CCTCATCGAAACCATCATTGTGG - Intronic
925749139 2:7071749-7071771 ACTCAACAAAACAGTCATCTAGG + Intergenic
926771836 2:16385039-16385061 CAGCAGCAAAATAATCATATTGG + Intergenic
927026938 2:19078075-19078097 CCCCAGCAAAACATTCTTATAGG - Intergenic
928789590 2:34934585-34934607 CCTGAGAAAAACAATCAATGGGG + Intergenic
930782421 2:55235883-55235905 CCTCAACACAACAGACATTTGGG + Intergenic
931324265 2:61202103-61202125 CTTCAGCAAAACCATCTTATTGG - Intronic
931780643 2:65576714-65576736 CCTCAGCAATACAGACATTTTGG - Intergenic
932465030 2:71914997-71915019 CCTGAGAAAAACAAGCATTGGGG - Intergenic
936275261 2:111090652-111090674 CCTGGGGAAAACCATCATTTGGG + Intronic
936943768 2:117912619-117912641 CCTGAGAAAAACAAGCATTGGGG + Intergenic
937513699 2:122628530-122628552 CCTCAACAACACAACCATCTAGG - Intergenic
938033945 2:128019978-128020000 GCTCAGAAAAAAAATTATTTTGG - Intronic
938865622 2:135416835-135416857 CCTCAGAAAAACAAGCAATGGGG + Intronic
939611818 2:144320316-144320338 ACTCACCAAAAAAATAATTTAGG - Intronic
940225654 2:151398673-151398695 CCTGAGCATAACAATGAGTTAGG + Intergenic
940325650 2:152422508-152422530 CCCCCACAAAAAAATCATTTCGG - Intronic
940629865 2:156224549-156224571 CCTGAGAAAAACAAGCATTAGGG + Intergenic
941268208 2:163390666-163390688 GCTCAGCAGATCTATCATTTGGG + Intergenic
942250234 2:174040991-174041013 CATTAGCAAAGCATTCATTTTGG - Intergenic
942853983 2:180524378-180524400 CCTCACCATCACAGTCATTTAGG - Intergenic
942989060 2:182177525-182177547 CCTCACCAAAACAAGCAATAGGG - Intronic
943287676 2:186025457-186025479 CCTGAGAAAAACAAGCATTGGGG + Intergenic
945227786 2:207550172-207550194 CCACAGCAAAACACATATTTGGG - Intronic
945429435 2:209747443-209747465 CCTGAGAAAAACAAGCAATTGGG - Intergenic
945818406 2:214633631-214633653 CCTCAGAAAAACAAGCAATGGGG - Intergenic
945939864 2:215937473-215937495 CATTAGCAAAACGATCAGTTTGG + Intergenic
1169174615 20:3499560-3499582 CCTGAGAAAAACAAGCATTGGGG + Intronic
1169666182 20:8038879-8038901 CCTCAGCAATAATAACATTTTGG + Intergenic
1169723348 20:8702506-8702528 CCTGAGAAAAACAATAATTTAGG + Intronic
1171438254 20:25140545-25140567 CCTCAGCAAAATACCCATATGGG - Intergenic
1171997849 20:31746627-31746649 CCTGAGCAAAACAAAGACTTTGG - Intronic
1172159612 20:32857475-32857497 CCTCTGCACAAAAATAATTTTGG - Intergenic
1174849412 20:53977794-53977816 ACTTAGCAAAGCACTCATTTTGG + Intronic
1178779052 21:35581839-35581861 AGTGAGCAAAACAATTATTTGGG + Intronic
1180375409 22:12088275-12088297 CCTCAGAAAAACAATCACTGGGG + Intergenic
1182819576 22:33203682-33203704 CCCCAGCAACTCAAGCATTTGGG + Intronic
1182983584 22:34695890-34695912 CTTCAGCCAAACAACCATTTGGG + Intergenic
1183806645 22:40217258-40217280 CTTCAACAAAACAATAATTTGGG - Intronic
949750402 3:7345829-7345851 CCTCAAAAAAAAAATCAATTTGG + Intronic
950374600 3:12560587-12560609 GCTAAGCAAAACAATCAATCTGG - Intronic
951167713 3:19502653-19502675 CCTCAGAAAAACAAGCAATGGGG + Intronic
951348217 3:21572419-21572441 CCCCATCAATACAATCATTTAGG - Intronic
951699632 3:25482360-25482382 CCTTTGAAAAATAATCATTTTGG + Intronic
954736114 3:52707589-52707611 CCTCAGCATAGGAGTCATTTGGG + Intronic
955712115 3:61791397-61791419 TCTAAGTAAAAGAATCATTTTGG - Intronic
956061402 3:65351765-65351787 CCTCTCCAACACAATGATTTAGG - Intergenic
956094156 3:65698602-65698624 CCTGAGAAAAACAAGCAATTGGG + Intronic
959835380 3:110912700-110912722 CCTGAGAAAAACAAGCATTGGGG - Intergenic
960502097 3:118450252-118450274 CCTCAACAAAACAAGCAATGGGG - Intergenic
963578621 3:147096049-147096071 CCTCAGAAAAACAAGCAATGGGG + Intergenic
963630670 3:147726310-147726332 CCTCAGAAAAACAAGCAATGGGG + Intergenic
964193135 3:154029614-154029636 TCTCAGCAAATCAATGAGTTTGG - Intergenic
964633372 3:158835976-158835998 CCTCAACAAAACAAAAAGTTGGG + Intergenic
965120539 3:164549281-164549303 AATCAGGAAAACAATGATTTTGG - Intergenic
966147861 3:176831780-176831802 CCTCAGAAAAACAAGCAATGGGG + Intergenic
966156728 3:176924650-176924672 CCTCAGAAAAACAAGCAATGGGG + Intergenic
966263923 3:178014942-178014964 CCTGAGAAAAACAAGCATTGGGG - Intergenic
967400298 3:189053420-189053442 TCTCAGGAAACCAAACATTTGGG + Intronic
970283684 4:14485539-14485561 CCTGAGAAAAACAATCAATTGGG + Intergenic
971474722 4:27061799-27061821 GCTCAGAAAAACAAACACTTAGG - Intergenic
971690485 4:29827878-29827900 TTTCTTCAAAACAATCATTTTGG - Intergenic
971936814 4:33160442-33160464 CCTCAGCACTACCAACATTTTGG - Intergenic
975534882 4:75439365-75439387 CCTCAGCAAAACACACATAGAGG + Intergenic
975644384 4:76531706-76531728 CCTCAGCCAACCAGTCACTTTGG + Intronic
976008304 4:80457226-80457248 CCACAACAAAAAAATCATATGGG + Intronic
976035182 4:80809853-80809875 CCTCCTCAAAACAATTTTTTGGG + Intronic
977506307 4:97907744-97907766 CCTCAGAAAAACAAGCAATGGGG + Intronic
979571833 4:122236225-122236247 ACTCAGTAAAAAAATCATTTAGG - Intronic
979873962 4:125863888-125863910 CCTGAGAAAAACAAGCATTGGGG - Intergenic
981121278 4:141053505-141053527 CTTCAGGAAAACAAGCATTTAGG + Intronic
981155533 4:141430716-141430738 AATCCTCAAAACAATCATTTAGG + Intergenic
981715520 4:147748051-147748073 CCTCAGCACTACGAACATTTGGG - Intronic
982648465 4:158054192-158054214 CACCAGAAAAACAATCTTTTGGG + Intergenic
983102036 4:163636972-163636994 CCTCAGAAAAACAAGCAATGGGG + Intronic
983385332 4:167054477-167054499 CCTCATCAAAACAATTTTTCAGG + Intronic
1202757005 4_GL000008v2_random:73716-73738 CCTCAGAAAAACAATCACTGGGG + Intergenic
986663134 5:10076787-10076809 CCTGAGCAAGCCAAACATTTTGG - Intergenic
987735713 5:21840732-21840754 CCTGAGAAAAACAAGCAATTGGG + Intronic
988153138 5:27413725-27413747 GAATAGCAAAACAATCATTTAGG - Intergenic
989504370 5:42209719-42209741 CCTGAGAAAAACAAGCATTGGGG + Intergenic
989996028 5:50832751-50832773 CATCGGCAAAATAATAATTTAGG - Intronic
990172353 5:53067236-53067258 ACTAAGCAAAACAATCAAGTGGG + Exonic
992099358 5:73391482-73391504 CTTCAGTAAAACAATGATATAGG + Intergenic
993027407 5:82662754-82662776 CCTTAGAAAAACTATCATTTAGG + Intergenic
993758897 5:91766878-91766900 CCTGAGAAAAACAAGCATTGGGG + Intergenic
993835282 5:92812275-92812297 CAAAATCAAAACAATCATTTGGG - Intergenic
993858202 5:93101409-93101431 CCTCAGCAAAAGATCCTTTTGGG + Intergenic
994663778 5:102684378-102684400 CCTGAGAAAAACAAGCAATTGGG - Intergenic
995380538 5:111527510-111527532 CCTCACGGAAACAATGATTTAGG - Intergenic
996629825 5:125617294-125617316 CCTCAGAAAAACAAGCAATGGGG - Intergenic
996965050 5:129298133-129298155 CCTGAGAAAAACAATCAATGGGG - Intergenic
997163659 5:131635471-131635493 CCTGAGCAAAAATAGCATTTTGG + Intronic
997194488 5:131969103-131969125 ACTCAGCAAAAGAATCCTTCAGG + Intronic
997549634 5:134740534-134740556 CCTCTGCAGAATATTCATTTTGG + Intronic
997708665 5:135983781-135983803 CCTGAGAAAAACAATCAATGGGG - Intergenic
997951170 5:138243699-138243721 TCTCAGCAAAACCATCAGCTGGG - Intergenic
998282560 5:140825720-140825742 CCTCATCAATATAATAATTTAGG - Intronic
999612607 5:153386252-153386274 CCTGAGAAAAACAATCAATGGGG + Intergenic
1000514726 5:162226117-162226139 CCTCAGCCACACAAGCAGTTGGG + Intergenic
1001226657 5:169950393-169950415 TCTCAGCATAACAGTCTTTTTGG + Intronic
1001372896 5:171224137-171224159 GCTGAGCAAAACAATGATGTGGG - Intronic
1003454074 6:6264508-6264530 CTTCAGGAACACCATCATTTAGG - Intronic
1003969103 6:11281144-11281166 CATCTGCAACACAAGCATTTGGG - Intronic
1004485014 6:16058287-16058309 CCTCAGTAAATTAATCAATTGGG + Intergenic
1004867076 6:19864117-19864139 CCTCAGAAAAGCCATCTTTTAGG + Intergenic
1006983189 6:38161949-38161971 CCCCAGCAAAACAAACGTTTAGG + Intergenic
1007453864 6:41961171-41961193 CTTCATCAAAACAATCCTTGTGG + Intronic
1007492452 6:42233987-42234009 CATCAGCACTACTATCATTTTGG + Intronic
1008183958 6:48367834-48367856 CCTGAGAAAAACAAGCAATTGGG + Intergenic
1009438930 6:63652796-63652818 AGGCACCAAAACAATCATTTGGG - Intronic
1009550574 6:65087321-65087343 CCTAAACAAAATAGTCATTTTGG - Intronic
1010590901 6:77710697-77710719 GCTCTGCATTACAATCATTTGGG + Intronic
1011296375 6:85830641-85830663 CCTGAGAAAAACAAGCAATTGGG - Intergenic
1013028540 6:106306211-106306233 TCACTGCAAAACAATGATTTTGG - Intronic
1014121357 6:117729012-117729034 CCTCATCTAGAGAATCATTTGGG + Intergenic
1016743018 6:147548304-147548326 CCTCAGAGAGACCATCATTTCGG + Intronic
1021163641 7:17306599-17306621 CCTCAGTAATACCAACATTTAGG - Intronic
1022641791 7:32193322-32193344 TCTCAGAAAAATAATAATTTAGG - Intronic
1025010953 7:55397989-55398011 GTTCAGAAAAGCAATCATTTGGG + Intronic
1025033295 7:55574188-55574210 GCTCAGCAAAACAATCTTCCAGG - Intergenic
1026065996 7:67073378-67073400 CCTCAGCACAACTGCCATTTTGG - Intronic
1026376415 7:69755473-69755495 ACTCAGCAACACAATTATTATGG - Intronic
1031580701 7:123471039-123471061 CCTCTGAATAACATTCATTTTGG - Intronic
1032146299 7:129384591-129384613 CTTCAGCAAAACAAGCACTTTGG - Intronic
1032740652 7:134735085-134735107 CATCAGCAACACAACCATTCAGG - Intergenic
1033960800 7:146910531-146910553 CCTGAGAAAAACAAGCATTGGGG + Intronic
1035904996 8:3499933-3499955 CCGGAGCAAAACAGTCATGTGGG + Intronic
1041829438 8:62137312-62137334 ATTCAGCAAAACTACCATTTAGG - Intergenic
1045152084 8:99419273-99419295 CCTCAGGAAAACAATCATGGTGG - Intronic
1045737111 8:105309194-105309216 CCTCAGAAAAACAAGCAATGGGG + Intronic
1045774823 8:105790350-105790372 CCTCAGAAAAACAAGCAATGGGG - Intronic
1045795573 8:106039547-106039569 CCTCAGAAAAACAAGCAATGGGG + Intergenic
1046153717 8:110260659-110260681 CCTGAGCAAAACAAGCAATGGGG + Intergenic
1048232735 8:132659785-132659807 CCTCAGCAATACTAACATTTTGG + Intronic
1048376099 8:133823531-133823553 ACTCAGCAAAAGAACCATCTGGG - Intergenic
1048792941 8:138120907-138120929 CCTGAGAAAAACAAGCATTGGGG + Intergenic
1050467177 9:5939732-5939754 CCTCAGCACAACTGACATTTGGG + Intronic
1050659105 9:7863410-7863432 CCTGAGAAAAACAAGCATTGGGG - Intronic
1050805722 9:9675717-9675739 ACTCACCAATACAAGCATTTTGG - Intronic
1052465097 9:28820165-28820187 GCTCAGGAAAAAACTCATTTTGG - Intergenic
1052563166 9:30111606-30111628 CCTGAGAAAAACAAGCATTGGGG + Intergenic
1053470489 9:38342821-38342843 CCTCTGAAAAACCAACATTTGGG - Intergenic
1053637980 9:40034440-40034462 CCTGAGAAAAACAAGCATTGGGG + Intergenic
1053768105 9:41430780-41430802 CCTGAGAAAAACAAGCATTGGGG - Intergenic
1053776894 9:41553267-41553289 CCTGAGAAAAACAAGCATTGGGG + Intergenic
1053937016 9:43169007-43169029 CCTGAGAAAAACAATCAATGGGG + Intergenic
1054318775 9:63631044-63631066 CCTGAGAAAAACAAGCATTGGGG + Intergenic
1054364833 9:64325218-64325240 CCTGAGAAAAACAAGCATTGGGG - Intergenic
1054546772 9:66342284-66342306 CCTGAGAAAAACAAGCATTGGGG - Intergenic
1059286648 9:113178464-113178486 CTTCTGTAAAACAATCATGTAGG + Intronic
1060932344 9:127497033-127497055 CCTCAGCCCAACAATCAGTGTGG - Intronic
1061752275 9:132787727-132787749 CCTGTACACAACAATCATTTTGG - Intronic
1203355306 Un_KI270442v1:132555-132577 CCTGAGAAAAACAATCAATGAGG + Intergenic
1203537796 Un_KI270743v1:58577-58599 CCTCAGAAAAACAATCACTGGGG + Intergenic
1186763114 X:12743493-12743515 CCTCAGCATTACTAACATTTTGG - Intergenic
1187971447 X:24663002-24663024 CCTCAGCATAATAGACATTTTGG - Intronic
1189688968 X:43595544-43595566 CCTCAACAAAATAATGAATTCGG + Intergenic
1192827815 X:74716801-74716823 CCTGAGAAAAACAAGCAATTGGG + Intergenic
1194099483 X:89686012-89686034 CCTCAGCAAATCAAATTTTTGGG + Intergenic
1194684113 X:96890687-96890709 CATCCTCAAAACAGTCATTTTGG + Intronic
1195029620 X:100913642-100913664 CCTGAGAAAAAGAGTCATTTTGG + Exonic
1195553976 X:106200312-106200334 CATCAGCAAAATAAACTTTTGGG + Intronic
1196306595 X:114110283-114110305 CCTCTTCAAGATAATCATTTTGG - Intergenic
1196935146 X:120722786-120722808 CCTCAGCAAAATCAGCATATAGG - Intergenic
1197638245 X:128940575-128940597 CCACAGCATAACAATCATTCAGG - Intergenic
1197928148 X:131668699-131668721 CCTGAGAAAAACAATCAATGGGG + Intergenic
1198042388 X:132866244-132866266 CCTCAGAAAAACAAACAATGGGG - Intronic
1199525052 X:148782867-148782889 CTTCAGGAAAACTATTATTTTGG - Intronic
1200452489 Y:3347390-3347412 CCTCAGCAAATCAAATTTTTGGG + Intergenic