ID: 1092980964

View in Genome Browser
Species Human (GRCh38)
Location 12:13793791-13793813
Sequence GACTTACTGATTGTGCTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092980964_1092980968 16 Left 1092980964 12:13793791-13793813 CCTCTGAGCACAATCAGTAAGTC 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1092980968 12:13793830-13793852 ACTTTTTGGAAGAAGGAAGTGGG 0: 1
1: 0
2: 7
3: 57
4: 548
1092980964_1092980966 9 Left 1092980964 12:13793791-13793813 CCTCTGAGCACAATCAGTAAGTC 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1092980966 12:13793823-13793845 AAATCAGACTTTTTGGAAGAAGG 0: 1
1: 1
2: 2
3: 45
4: 407
1092980964_1092980965 2 Left 1092980964 12:13793791-13793813 CCTCTGAGCACAATCAGTAAGTC 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1092980965 12:13793816-13793838 ATCTTCAAAATCAGACTTTTTGG 0: 1
1: 0
2: 2
3: 40
4: 417
1092980964_1092980971 27 Left 1092980964 12:13793791-13793813 CCTCTGAGCACAATCAGTAAGTC 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1092980971 12:13793841-13793863 GAAGGAAGTGGGAGAGGGTTAGG 0: 1
1: 0
2: 8
3: 89
4: 958
1092980964_1092980970 22 Left 1092980964 12:13793791-13793813 CCTCTGAGCACAATCAGTAAGTC 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1092980970 12:13793836-13793858 TGGAAGAAGGAAGTGGGAGAGGG 0: 1
1: 0
2: 20
3: 187
4: 1618
1092980964_1092980967 15 Left 1092980964 12:13793791-13793813 CCTCTGAGCACAATCAGTAAGTC 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1092980967 12:13793829-13793851 GACTTTTTGGAAGAAGGAAGTGG 0: 1
1: 0
2: 4
3: 81
4: 512
1092980964_1092980969 21 Left 1092980964 12:13793791-13793813 CCTCTGAGCACAATCAGTAAGTC 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1092980969 12:13793835-13793857 TTGGAAGAAGGAAGTGGGAGAGG 0: 1
1: 0
2: 9
3: 80
4: 904

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092980964 Original CRISPR GACTTACTGATTGTGCTCAG AGG (reversed) Intronic
904418680 1:30377788-30377810 GACTCAGTGATGTTGCTCAGAGG + Intergenic
908560764 1:65303870-65303892 GCCTTACTAAGTGTGGTCAGTGG - Intronic
911952895 1:104198751-104198773 GATTTCCTGTTTGTTCTCAGTGG - Intergenic
913193525 1:116433519-116433541 GTATTACTGGCTGTGCTCAGCGG + Intergenic
914909764 1:151775482-151775504 GACTCACTCATTGTGCTGACTGG - Exonic
915792881 1:158694389-158694411 GACTTAGTAAATGTCCTCAGAGG - Intergenic
917657464 1:177140927-177140949 CACTTACTGGCTGGGCTCAGTGG + Intronic
924549271 1:245059559-245059581 AAACTACTGAATGTGCTCAGTGG + Intronic
1063901924 10:10742401-10742423 GACAGACTGCTTGAGCTCAGGGG + Intergenic
1066135388 10:32440559-32440581 AACTCACTGAGTGTGCTCTGTGG + Intergenic
1072176908 10:92934415-92934437 GACTTACTGAATGAGCTCTAAGG - Exonic
1073680438 10:105697841-105697863 GATGTACTGATGGTGATCAGAGG + Intergenic
1074498336 10:113999652-113999674 GACTTACTGCTTGGGGTCAATGG - Intergenic
1074669181 10:115768810-115768832 GACTTACAGATTGTGCTCCTGGG + Intronic
1076611938 10:131731565-131731587 GAGTTGCTGATTGTGCTGAGTGG - Intergenic
1081886866 11:46505595-46505617 GACTTACTGTTTTTTCTCAGGGG - Intronic
1086988726 11:93279255-93279277 GACTGACTGACTTTGCCCAGGGG + Intergenic
1088074918 11:105836266-105836288 GACTCACTTATCTTGCTCAGGGG + Intronic
1092980964 12:13793791-13793813 GACTTACTGATTGTGCTCAGAGG - Intronic
1096209168 12:49749719-49749741 GACTTACAGGTTGGGCACAGTGG - Intronic
1096472468 12:51888256-51888278 GACCCAGTGATTGTGCTCCGCGG + Exonic
1097867549 12:64571427-64571449 GGCTTCCTGATTGTGCTCACTGG - Intergenic
1099153078 12:79139824-79139846 GACTCACTCATTCTGCTCAGTGG - Intronic
1107675514 13:42792756-42792778 GACTTAGTAATTGTGCTCCTAGG - Intergenic
1107994769 13:45849244-45849266 CACTTATGGATTTTGCTCAGAGG - Intronic
1110158779 13:72351083-72351105 GACTCACTGCTTTTCCTCAGAGG + Intergenic
1112208293 13:97347251-97347273 GATTTACTTATTGTGCTGAAGGG - Intronic
1116380291 14:44259337-44259359 GACTTTCTGATTCTGCTGAAAGG - Intergenic
1119843437 14:77810501-77810523 GACTTACTCAAGGTGTTCAGAGG + Intronic
1126381188 15:48048997-48049019 GACAAACTGATTGGGCTGAGGGG + Intergenic
1130622816 15:85481407-85481429 GACTTACTGTGTGTGGTCAGTGG + Intronic
1130931861 15:88434530-88434552 GCCTTTCTGACTGGGCTCAGTGG - Intergenic
1131470391 15:92691425-92691447 GACAGATTGCTTGTGCTCAGGGG + Intronic
1133380127 16:5322867-5322889 GTCATACTGATTGTTTTCAGTGG + Intergenic
1135587489 16:23681921-23681943 GACTTAGGGATTGTCTTCAGGGG + Intronic
1138700806 16:58861121-58861143 GACCAACTGATTGTGCTAAATGG + Intergenic
1138922242 16:61545769-61545791 GAATTACTGTTTTAGCTCAGGGG + Intergenic
1139407541 16:66730959-66730981 AACTGACTGATTGTTCTCACAGG + Intronic
1142290549 16:89192057-89192079 GGGTTACTCATTGTGCCCAGAGG + Intronic
1143979015 17:10851943-10851965 GACTTCTTCATTGTCCTCAGAGG - Intergenic
1150613929 17:66754519-66754541 GGCTTAAAGACTGTGCTCAGGGG + Intronic
1151611124 17:75175918-75175940 GACTTACTGGCTGGGCGCAGTGG - Intergenic
1152724960 17:81940645-81940667 GACTTCCAGACTGGGCTCAGAGG - Exonic
1153448178 18:5196905-5196927 GAGTTACTGTCTGTGCTCATGGG - Intronic
1155164428 18:23221051-23221073 GGCTTCCTGAAGGTGCTCAGGGG - Intronic
1155901600 18:31397444-31397466 GATTTTCTGATTGTGTCCAGAGG - Intronic
1158891600 18:61877194-61877216 GACTTACGTATTTTGGTCAGGGG + Intronic
1168089872 19:54075471-54075493 GGATTCCTGATTGGGCTCAGGGG - Intronic
927000739 2:18791733-18791755 GTCTTGCTGCTTGTTCTCAGGGG - Intergenic
927761132 2:25755431-25755453 GAATTACTGACTGTGATCACTGG - Intronic
928951605 2:36818046-36818068 GCCATACTGATGGTGTTCAGAGG + Intergenic
929518910 2:42629488-42629510 TACTGACTGGCTGTGCTCAGTGG - Intronic
932394553 2:71432424-71432446 GACAGACTGCTTGAGCTCAGGGG - Intronic
936141862 2:109947854-109947876 GACTTCCTGGCTGTGCTCGGAGG + Intergenic
936178550 2:110245802-110245824 GACTTCCTGGCTGTGCTCGGAGG + Intergenic
936202828 2:110423630-110423652 GACTTCCTGGCTGTGCTCGGAGG - Intronic
938015395 2:127863000-127863022 GTCTCACTGAGCGTGCTCAGGGG + Exonic
938715552 2:134018349-134018371 TACTTACTGATGGTGGTGAGTGG - Intergenic
948922746 2:241073395-241073417 GACTGACTGACTGCTCTCAGGGG + Intronic
1170069769 20:12353599-12353621 TCCTTACTGATTGTTCTCATGGG - Intergenic
1170132538 20:13036799-13036821 GACTAACTGATGGGTCTCAGTGG - Intronic
1174334049 20:49845232-49845254 TCCTTCCTGGTTGTGCTCAGTGG + Intronic
1176124116 20:63467586-63467608 GACTTGCTGAGTGTGCACACAGG + Intronic
1176926175 21:14752108-14752130 GACATCTTGATTGTGCTCTGAGG - Intergenic
1179433999 21:41347181-41347203 GACTTTCTGCTTGTCCCCAGAGG - Intronic
949529758 3:4944031-4944053 GTTCTACAGATTGTGCTCAGTGG - Intergenic
955341586 3:58129433-58129455 GACTTAAAGATTGGCCTCAGAGG + Intronic
959805196 3:110542924-110542946 GCCATGCTGACTGTGCTCAGAGG + Intergenic
964169870 3:153757145-153757167 CATTTTCTGATTGTTCTCAGTGG + Intergenic
964816505 3:160723262-160723284 AACTTACTGGCTGGGCTCAGTGG + Intergenic
965140486 3:164827159-164827181 GACGTAATGATTGTGATAAGTGG - Intergenic
970670152 4:18387380-18387402 GGCAGACTGATTGAGCTCAGGGG - Intergenic
978822838 4:112985713-112985735 GACTTTCTGATTATGCTCCATGG + Intronic
982840754 4:160182661-160182683 GAACTTCTGATTGTCCTCAGAGG + Intergenic
983120330 4:163875827-163875849 GATTAACTGATTTTGATCAGGGG + Intronic
983906895 4:173192688-173192710 GTCTTCCTGTTTGTGTTCAGTGG + Intronic
986154008 5:5155753-5155775 GACTTCCTGTTTGTCCCCAGTGG - Intronic
987154719 5:15077680-15077702 GGCTTACTGCTTGTGCCCTGCGG - Intergenic
987884380 5:23794664-23794686 GACTTACTAAATCTGCTCATGGG - Intergenic
993437601 5:87916536-87916558 GAGCTACTGATTGGGCTCACTGG - Intergenic
999786591 5:154896152-154896174 GGCTTCCTGATACTGCTCAGGGG + Exonic
1001773869 5:174314454-174314476 GACTTGCTGAATGTTCCCAGAGG + Intergenic
1005688894 6:28282607-28282629 GACTCACTGATTGTGTATAGAGG + Intronic
1011981365 6:93382980-93383002 GACTTGTTGATTGGGTTCAGTGG - Intronic
1012855556 6:104497204-104497226 TACTTCCTAATTGTCCTCAGGGG - Intergenic
1017704291 6:157106703-157106725 GAATTACAGGTTCTGCTCAGTGG + Intronic
1018609351 6:165632403-165632425 GTCTCACTGTTTGTCCTCAGGGG - Intronic
1019516460 7:1442326-1442348 GAGGTACTGCTCGTGCTCAGCGG + Exonic
1028029182 7:85887714-85887736 GACTTCCTGAGTATGCTCTGTGG + Intergenic
1028194711 7:87892782-87892804 GACTTACTCATTGTCCTGTGGGG + Intronic
1031078237 7:117233099-117233121 GCCTTAATGCTTGTCCTCAGGGG - Intergenic
1043103883 8:76083340-76083362 GAGTTACTGCTTGTGCTCTCTGG + Intergenic
1044886355 8:96782307-96782329 GACTTACTGCTTGTGCACTCAGG + Intronic
1046089405 8:109481478-109481500 GACTTAAAGATTGTTCTTAGAGG + Exonic
1048274187 8:133053393-133053415 GGCTTACTGAATGTGCAGAGCGG + Intronic
1048596600 8:135873308-135873330 CACCTACTGATTGCGCACAGTGG + Intergenic
1050148165 9:2592018-2592040 GACTTACAGCTTGTGCTCTCAGG + Intergenic
1051026590 9:12620200-12620222 TATTTTTTGATTGTGCTCAGAGG - Intergenic
1051427829 9:16951527-16951549 GACTTACTCAATGTGATAAGGGG - Intergenic
1060073176 9:120568525-120568547 GATTTACTGATTTTGCTCCAGGG + Intronic
1186104291 X:6189468-6189490 GACATACTGATAATGCCCAGTGG + Intronic
1186350393 X:8733138-8733160 CACTTCCTGATGGGGCTCAGGGG - Intergenic
1189165760 X:38859273-38859295 GCTTTAATGACTGTGCTCAGTGG + Intergenic
1191958264 X:66670031-66670053 GACCTACTGATTCTGCTCCTAGG - Intergenic
1196113532 X:111972612-111972634 GAATTGCTGATTGTGGTTAGAGG + Intronic
1197150347 X:123213906-123213928 GACTGACTTCTTGTACTCAGAGG - Intronic
1198193767 X:134338734-134338756 GGCTGAATGATTGTGCTCAAAGG - Intergenic
1199003677 X:142671341-142671363 GAGTTACTGATTCTGTTCTGAGG - Intergenic