ID: 1092984252

View in Genome Browser
Species Human (GRCh38)
Location 12:13829981-13830003
Sequence GGATGGAACAAGAGTCTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 222}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092984252 Original CRISPR GGATGGAACAAGAGTCTGTG TGG Intronic
900260960 1:1729182-1729204 GGAGGGCACCAGATTCTGTGCGG + Intronic
902680091 1:18037199-18037221 GAAGGGAACAAGAGTGTTTGTGG + Intergenic
902882789 1:19383867-19383889 GGATGGAAGAAGAGGAGGTGGGG - Intronic
903261363 1:22133438-22133460 GGATGGCACACGTGTCTCTGGGG - Intronic
903884727 1:26534400-26534422 GGAAAGAACATGAGGCTGTGTGG + Intronic
906096832 1:43229596-43229618 AGTTGGAAAAAGAGTATGTGAGG - Intronic
906534701 1:46544989-46545011 GGCTGGGGCAAGAGGCTGTGGGG - Intergenic
907758392 1:57333475-57333497 GGAAGGAACAAGCATGTGTGGGG - Intronic
909876216 1:80807133-80807155 GGAGGGAACAAGAGCAAGTGGGG + Intergenic
911343868 1:96673646-96673668 GAAGGGAACAAGAGTCTGCCTGG - Intergenic
912050593 1:105524148-105524170 GGTTGGAAAAAGAGGCTGAGTGG + Intergenic
912370262 1:109168230-109168252 GAGTGTAACAGGAGTCTGTGGGG - Intronic
914442669 1:147720884-147720906 GGTTGAAGCAAGAGACTGTGAGG - Intergenic
915134192 1:153718327-153718349 GAATAGAAAAAGATTCTGTGGGG - Intergenic
915186169 1:154106697-154106719 AGAAGGAACAAGAGTCTGCCTGG + Intronic
915786816 1:158622714-158622736 GGATGGAACAAGAGGATGGGAGG - Intronic
916915255 1:169399986-169400008 GGATGCTCCAAGAGTCTGTGTGG + Intronic
917076562 1:171212267-171212289 GAAGGGAAAAAGAGTGTGTGAGG - Intergenic
917474032 1:175352944-175352966 GGATGGAGGAAGAGGCTCTGAGG + Intronic
918521447 1:185419454-185419476 GATTTGAACAATAGTCTGTGAGG + Intergenic
919777137 1:201201632-201201654 GGATGGTACCAGAGCCTATGAGG + Intronic
920455863 1:206100629-206100651 GGGTTGAACAAGAGTCTCTGAGG - Intronic
920647109 1:207811835-207811857 GGATGGAACCAGAATCTCTTTGG - Intergenic
921268741 1:213448343-213448365 GGATGGAAGCAGAGTCTCTGGGG + Intergenic
923012855 1:230102762-230102784 TGATGGAAACAGATTCTGTGGGG + Intronic
924665565 1:246067972-246067994 AGAAGGAACAAGAGACCGTGTGG + Intronic
1063200245 10:3780598-3780620 GGATGGAACAGAAGTGTGTTTGG - Intronic
1063414088 10:5859187-5859209 GGTTGAAACAGGAGTCTGTAGGG - Intergenic
1063731771 10:8705720-8705742 GGATAGAATAAAAGTCTGAGAGG - Intergenic
1063927125 10:10991374-10991396 GGATGTGACAAGAGTCTCAGTGG + Intergenic
1064127670 10:12677672-12677694 GGAGGGAAGAAGAGTCTGTGAGG + Intronic
1064297322 10:14090146-14090168 GAACGGAACAAGAGTCTTCGGGG + Intronic
1065511066 10:26478813-26478835 GGATGGAGCCAGAATCTCTGGGG + Intronic
1067188220 10:44048139-44048161 CGATGGGAGAAGAGTCTGGGAGG - Intergenic
1070789531 10:79181103-79181125 AGACGGACCAAGAGTCAGTGTGG + Intronic
1071032845 10:81205517-81205539 GGCTGGAGAAAGAGGCTGTGTGG - Intergenic
1071381197 10:85061821-85061843 GGAAAGAAGATGAGTCTGTGAGG + Intergenic
1071449912 10:85784429-85784451 GGACAGAACTAGAGTCTGTCCGG + Intronic
1072229003 10:93397833-93397855 GACTGGAACAAGAGTCAGTTTGG - Intronic
1074592495 10:114826314-114826336 GAATGGAACATGATTCTGTCTGG - Intronic
1077767084 11:5170755-5170777 GGAGGCAATAAGAGTGTGTGAGG + Intronic
1079972431 11:27052542-27052564 GGCTGGAACAAAAGGCTATGAGG - Intronic
1080839919 11:35974688-35974710 TGATGAAACAAGAGACTGTATGG - Intronic
1081065366 11:38534116-38534138 GGGTAGAAAAAGAGGCTGTGTGG + Intergenic
1081072891 11:38631973-38631995 GGATGGAAAAAGAGGCTGAGTGG - Intergenic
1081813509 11:45926350-45926372 GAGTGGGACAAGAGGCTGTGTGG + Intronic
1084833407 11:71786821-71786843 GGAGGGACCAAGAGACTGGGAGG - Intergenic
1085038764 11:73314745-73314767 GGAGGTAACAAGAGTGTGGGAGG - Intronic
1085201466 11:74704729-74704751 GGCTGCAGCAAGAGGCTGTGGGG + Intronic
1088348667 11:108860130-108860152 CTATGGTACAAGAATCTGTGTGG + Intronic
1089919764 11:122197584-122197606 GGATGGAACCAGATTCTGGAGGG - Intergenic
1091323560 11:134668058-134668080 GGAAGGAAGAAGAGAGTGTGAGG + Intergenic
1091784135 12:3231999-3232021 GGAGGGATTAAGAGTCTGTAGGG + Intronic
1092984252 12:13829981-13830003 GGATGGAACAAGAGTCTGTGTGG + Intronic
1094278014 12:28700843-28700865 GGATGGAACAAGGGACTGACTGG + Intergenic
1094392054 12:29962520-29962542 GAATAGACAAAGAGTCTGTGTGG - Intergenic
1095270677 12:40215079-40215101 AGATGGAACAAGGCTCAGTGGGG - Intronic
1095430141 12:42125305-42125327 GGTTTGAACATGAGTCTCTGAGG + Intronic
1096555517 12:52401146-52401168 GGCTGGCACAGGAGTCTGAGGGG + Intronic
1096789394 12:54035531-54035553 GGCTGCAACAAGAGCCTCTGGGG + Intronic
1097816547 12:64080693-64080715 GGAAGGAAGAAGAGACTGGGGGG - Intronic
1104112841 12:125719757-125719779 GTTTGGAACAAGAATCTATGGGG + Intergenic
1105897302 13:24727118-24727140 GGATGGAGGAAGGGTCAGTGAGG + Intergenic
1106421232 13:29587884-29587906 GGAGGGATCACGAGTCTGTGTGG + Intronic
1108245103 13:48506119-48506141 CCGTGGAATAAGAGTCTGTGAGG + Intronic
1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG + Intergenic
1110809023 13:79791410-79791432 GCCTGGAACCTGAGTCTGTGAGG + Intergenic
1111227872 13:85298818-85298840 GGATGGAAAAAGTGTGTGGGTGG + Intergenic
1112344719 13:98579508-98579530 GGATGAAACAATGGTCAGTGTGG - Intergenic
1115848839 14:37570936-37570958 GGTTGGAACAAAAGTCTGAAGGG - Intergenic
1115894431 14:38069835-38069857 TGATTTAACAAAAGTCTGTGAGG + Intergenic
1117377248 14:55128172-55128194 GGTTGGAACAAGGATCTCTGAGG - Intronic
1119246230 14:73110829-73110851 AGATGGAACAAGAGGCTGAGAGG + Exonic
1120841749 14:89091736-89091758 GGAAGGGAAAAGGGTCTGTGTGG + Intergenic
1122864147 14:104595933-104595955 GGCTGGAAACAGTGTCTGTGAGG + Intronic
1123062152 14:105599275-105599297 GGATGGACCAAGGGGCGGTGGGG + Intergenic
1123086897 14:105721003-105721025 GGATGGACCAAGGGGCGGTGGGG + Intergenic
1124862531 15:33456598-33456620 GGATGGAAAAATGGTCTATGTGG - Intronic
1125101086 15:35913383-35913405 GGATGGGAAAAGGGTATGTGGGG + Intergenic
1127981452 15:64038170-64038192 GGATTGGACTAGAGTCTGGGTGG - Intronic
1130189907 15:81724145-81724167 AGGTGGAACAAGCATCTGTGTGG - Intergenic
1131321677 15:91399838-91399860 GCCTGGAACCTGAGTCTGTGTGG + Intergenic
1132412812 15:101597436-101597458 GGAGTGAAGAAGACTCTGTGAGG + Intergenic
1132584528 16:700511-700533 GGAAGGAACACGAGGCTCTGAGG + Intronic
1132887871 16:2190363-2190385 GGATGGAAGGAGACTCAGTGAGG + Intronic
1133887839 16:9847190-9847212 AGATGGAAGAAGAATGTGTGGGG + Intronic
1134264268 16:12679971-12679993 GAATGGAAGAAAAGTCTGTCTGG - Intronic
1135261325 16:20983448-20983470 GGAAGGAACAATAGTGTGTATGG - Intronic
1135805989 16:25543133-25543155 GGATGGCCCCAGAGACTGTGAGG - Intergenic
1141787672 16:86212757-86212779 GGAAGGGACCACAGTCTGTGTGG - Intergenic
1141787762 16:86213161-86213183 GGAAGGAACCATGGTCTGTGTGG - Intergenic
1143388691 17:6547454-6547476 TTATGGAACAAGAGTCTGGCGGG - Intronic
1144554839 17:16272962-16272984 GGATGAAACAGGATTCTGAGAGG + Intronic
1147125618 17:38366106-38366128 GGCTGGAACAAAAAGCTGTGTGG - Intronic
1147629360 17:41919711-41919733 GGTGGGAACAAGAGACTGTCTGG - Intronic
1150185748 17:63179753-63179775 GGATGGAACAGGATTCTTAGAGG - Intronic
1151911495 17:77086430-77086452 GGCTGGAGCAGGGGTCTGTGTGG + Intergenic
1157592184 18:48842619-48842641 GGCTGGAACAAGGCCCTGTGGGG - Intronic
1162944914 19:14037131-14037153 GTATGGATCAAGAATATGTGGGG - Intronic
1163151472 19:15417706-15417728 GAATGCAACGTGAGTCTGTGGGG - Intronic
1163751776 19:19082396-19082418 TGATGGAGCAAGACTCTGTCAGG - Intronic
1165216369 19:34276436-34276458 TGAGGGAAAAAGAGTGTGTGTGG + Intronic
1166030785 19:40125609-40125631 CTATGGACCAAGAGTGTGTGGGG + Intergenic
1166780781 19:45341508-45341530 TGATTGACCAAGAGGCTGTGCGG + Intronic
1167758592 19:51428752-51428774 GGATGGAACAAAGGTCAGAGAGG + Intergenic
1168406374 19:56112647-56112669 GGAAGGAATAAGAGACTGGGGGG - Intronic
1168717809 19:58539405-58539427 GGAGGGAAGCAGAGTGTGTGTGG - Intergenic
1168717875 19:58539714-58539736 GGAGGGAAGCAGGGTCTGTGTGG - Intergenic
1168717884 19:58539753-58539775 GGAGGGAAGCAGGGTCTGTGTGG - Intergenic
1168717893 19:58539792-58539814 GGAGGGAAGCAGGGTCTGTGTGG - Intergenic
1168718011 19:58540297-58540319 GGAGGGAAGCAGGGTCTGTGTGG - Intergenic
1168718063 19:58540488-58540510 GGAGGGAAGTAGGGTCTGTGTGG - Intergenic
1168718138 19:58540797-58540819 GGAGGGAAGCAGGGTCTGTGTGG - Intergenic
1168718148 19:58540836-58540858 GGAGGGAAGCAGGGTCTGTGTGG - Intergenic
1168718157 19:58540875-58540897 GGAGGGAAGCAGGGTCTGTGTGG - Intergenic
1168718166 19:58540914-58540936 GGAGGGAAGCAGGGTCTGTGTGG - Intergenic
1168718254 19:58541265-58541287 GGAGGGAAGCAGGGTCTGTGTGG - Intergenic
1168718376 19:58541765-58541787 GGAGGGAAGCAGGGTCTGTGTGG - Intergenic
1168718394 19:58541843-58541865 GGAGGGAAGCAGGGTCTGTGTGG - Intergenic
1168718431 19:58541996-58542018 GGAGGGAAGCAGGGTCTGTGTGG - Intergenic
1168718441 19:58542035-58542057 GGAGGGAAGCAGGGTCTGTGTGG - Intergenic
1168718450 19:58542074-58542096 GGAGGGAAGCAGGGTCTGTGTGG - Intergenic
1168718459 19:58542113-58542135 GGAGGGAAGCAGGGTCTGTGTGG - Intergenic
1168718486 19:58542230-58542252 GGAGGGAAGCAGGGTCTGTGTGG - Intergenic
1168718536 19:58542426-58542448 GGAGGGAAGCAGGGTCTGTGTGG - Intergenic
1168718609 19:58542735-58542757 GGAGGGAAGCAGCGTCTGTGTGG - Intergenic
1168718616 19:58542774-58542796 GGAGGGAAGCAGGGTCTGTGTGG - Intergenic
928311110 2:30210665-30210687 AGAGGAAACAAGAGTTTGTGGGG + Intergenic
929524896 2:42693036-42693058 GAAAAGAACAAGAGTCTGTCTGG - Intronic
932455056 2:71844239-71844261 GGGTGGAGGAAGGGTCTGTGGGG - Intergenic
932822324 2:74912064-74912086 GGATGGAGCAAGAGTCCCTGGGG + Intergenic
934898263 2:98137512-98137534 GGCTCCAACAAGACTCTGTGAGG + Intronic
939227588 2:139383548-139383570 GGAAGGCAGAAGAGTCTGTCAGG + Intergenic
939503543 2:143015320-143015342 GAATGGAAAAAGAGGGTGTGGGG + Intronic
940585196 2:155639286-155639308 GGATAGAACAAAAGTCTTTCAGG - Intergenic
940909717 2:159199942-159199964 GGATGGAACAAACAGCTGTGAGG - Intronic
941961288 2:171256287-171256309 GAATAGATGAAGAGTCTGTGTGG - Intergenic
942494962 2:176530352-176530374 AGATGGAAAAAGAAGCTGTGCGG - Intergenic
943379610 2:187127893-187127915 GGATGGAGCAAGGGTCTCTCTGG - Intergenic
943775455 2:191761035-191761057 AGATGGAAGAAGAGGCTGTAAGG + Intergenic
946779637 2:223179768-223179790 GGATGGAACAAGGCTCAGAGAGG + Intronic
948165594 2:235859401-235859423 GGATGGAACAAAAGGCGGGGGGG - Intronic
1169203993 20:3730035-3730057 GGCTGGAAAAAGAGTTTGGGAGG + Intergenic
1170085753 20:12529866-12529888 GGATGGGACATGAGCCTGAGAGG + Intergenic
1170807666 20:19647151-19647173 GGATGGAACATGCCTCTGAGAGG - Intronic
1171282927 20:23916618-23916640 AGATGGATCAAGATGCTGTGAGG - Intergenic
1172163804 20:32886548-32886570 GGGTGGAACTAGGGTCTGTGGGG + Intronic
1172992364 20:39046045-39046067 GGAGGGAACAAGAGTCCCTATGG - Intergenic
1173045268 20:39503730-39503752 GGAAGGAGGAAGAGTCTGTAAGG + Intergenic
1175514431 20:59559926-59559948 GGAGGGAACAAGAGCCTCAGTGG - Intergenic
1176296903 21:5078337-5078359 GGATGGAACAGGAGCTGGTGAGG + Intergenic
1177410785 21:20728231-20728253 GGCTGGCACAAGGGTCTGAGTGG + Intergenic
1179594520 21:42433446-42433468 TGATGGGAGCAGAGTCTGTGTGG - Intronic
1179860125 21:44183610-44183632 GGATGGAACAGGAGCTGGTGAGG - Intergenic
1181759716 22:25049779-25049801 GGATGGAATAAAAGTGTGTGTGG + Intronic
1181969658 22:26680619-26680641 GAATGAAACAAGAGTCAGTTGGG + Intergenic
1183081941 22:35462415-35462437 CAATGGAACCAGAGTCTGTGGGG + Intergenic
1183987416 22:41577171-41577193 AGATGGGGCCAGAGTCTGTGTGG - Exonic
1184755367 22:46512826-46512848 GGAAGGAACAAGAGGGTGGGGGG - Intronic
1184800072 22:46753739-46753761 GGATGGAAAGAGAGACTGGGGGG - Intergenic
1185144536 22:49123867-49123889 GGATGGAACTGGAGTGTGGGCGG - Intergenic
949591884 3:5503238-5503260 AGATGGAGCCAGAATCTGTGTGG + Intergenic
949672412 3:6414793-6414815 GGTTGGAACAACAGTATGAGGGG + Intergenic
952990004 3:38823732-38823754 AGATGGATTAAGAGTCTGAGAGG - Intergenic
953327288 3:42023312-42023334 GGATGCAACTTGAGTTTGTGAGG - Intronic
954782852 3:53073532-53073554 GGCTGGACCAAGGGTCAGTGAGG + Intronic
957541815 3:81580704-81580726 GGATGGAACAGGGGTCAGGGAGG + Intronic
959721097 3:109490368-109490390 GGTTGGAAAGAGAGTCTCTGAGG + Intergenic
967881309 3:194303747-194303769 AGATGGCAAAAGAGTCTGAGAGG + Intergenic
968707221 4:2085421-2085443 AGAAGGGACAAGAGTCTGGGCGG - Intronic
972303730 4:37811554-37811576 GTATTGAAGAAGAGGCTGTGAGG - Intergenic
973865257 4:55106616-55106638 GGATGGTACAATAATATGTGAGG - Intronic
977376698 4:96214060-96214082 GGATGGAACAAGTTGCTTTGGGG - Intergenic
979411678 4:120386729-120386751 TGATGGAATAAAAGTCTTTGCGG + Intergenic
980003948 4:127519664-127519686 AGCTCAAACAAGAGTCTGTGAGG - Intergenic
980385691 4:132086285-132086307 GGCTGGGAAAAGAGTCTGAGTGG + Intergenic
980705590 4:136488828-136488850 GAATGGAAAGACAGTCTGTGGGG + Intergenic
981718653 4:147777206-147777228 TAATTGAACTAGAGTCTGTGTGG + Intronic
982202739 4:152975399-152975421 CGATGGAGCTAGAGTCTGTGGGG + Exonic
982654746 4:158133760-158133782 GAATGGCACAACAGTCTGTCAGG - Intronic
984633177 4:182081780-182081802 GGATGGATCAAGAATCTACGGGG - Intergenic
986707518 5:10463926-10463948 GGAGGGGACAAGACTCTGGGTGG - Intronic
988241739 5:28620432-28620454 GGCTAGAACAAAAATCTGTGAGG - Intergenic
989592007 5:43121068-43121090 GCACGGAACAAGAGGCTCTGAGG + Intronic
991101189 5:62795254-62795276 ATTTGGAACAAGATTCTGTGTGG + Intergenic
991482370 5:67095182-67095204 GCATGGCACAAGGGCCTGTGGGG - Intronic
995436911 5:112146469-112146491 TGATGGTGCAAGAGTCTTTGGGG - Intronic
995602217 5:113810032-113810054 GGATGTGACAAAAGGCTGTGTGG + Intergenic
997474683 5:134136038-134136060 GGATGGGGCAAGAGACTGTCTGG + Intronic
997943266 5:138177623-138177645 GGATGGACCATGGCTCTGTGGGG + Exonic
998384934 5:141751785-141751807 GGAAGGAAGAATATTCTGTGGGG + Intergenic
1000418593 5:161011148-161011170 TGATGGAATCAGAGTCTCTGAGG + Intergenic
1001524872 5:172421680-172421702 GGAAGGCACAGGAGTGTGTGGGG + Intronic
1004886368 6:20054938-20054960 GAATGGAACAACTGGCTGTGTGG + Intergenic
1005735919 6:28745974-28745996 GGATGGAACTATGTTCTGTGCGG + Intergenic
1005955071 6:30657851-30657873 GGATGGAACTTGACTCTGTGGGG - Intronic
1006901157 6:37502583-37502605 GGTTGGAATGAGAGTCTATGTGG + Intergenic
1007902581 6:45424117-45424139 GGCAGGCACAAGAGTCTGCGGGG - Intronic
1007939223 6:45761720-45761742 GTATGGAAGAGAAGTCTGTGTGG - Intergenic
1009918639 6:70028441-70028463 GAATAGACCAAGAGTCTGTCTGG + Intronic
1014640905 6:123909273-123909295 AGAGGGGACAAGAGTGTGTGTGG - Intronic
1019477268 7:1249930-1249952 GGCTGGAACCAGAGCCTGGGGGG + Intergenic
1028615347 7:92759674-92759696 GGATGGAACAACAGACTTTAAGG + Intronic
1031152933 7:118075660-118075682 TGATGAGAGAAGAGTCTGTGAGG + Intergenic
1031833746 7:126657347-126657369 GGTTGGTACAAGAGTATTTGCGG - Intronic
1032942561 7:136811314-136811336 GAATAGAACAAGAGTCTGCTTGG + Intergenic
1034233373 7:149549834-149549856 GCATGGAACCAAATTCTGTGTGG - Intergenic
1034389628 7:150775221-150775243 GAAGGGAACAAGAGACTCTGGGG + Intergenic
1036206026 8:6806293-6806315 GGATGGGACAAGAGTGAGTGCGG + Intergenic
1037766602 8:21776060-21776082 GGATGGGAAATGAGTCTGTGAGG - Intronic
1039445574 8:37629173-37629195 GAATGAAACAATAGTCTTTGGGG + Intergenic
1039494146 8:37968175-37968197 GGATGAATCAAGAGGCTGAGAGG + Intergenic
1039569866 8:38578168-38578190 GGATGGAATCAGAATCTCTGGGG + Intergenic
1040667369 8:49650595-49650617 GGATAGAACAAGAGGCTGCCCGG - Intergenic
1042142802 8:65696534-65696556 GGATGGAAGAGAAGTATGTGTGG - Intronic
1042825547 8:72975760-72975782 GGATGGCTCAAAAGTCTGTGAGG - Intergenic
1043674582 8:82935483-82935505 TGATGGAACCAGAATGTGTGGGG + Intergenic
1043867489 8:85392625-85392647 GGAGGTAACAAGAGTCAGTCTGG + Intronic
1044547474 8:93475928-93475950 GGCTGGAACAAGGGACTGTGAGG - Intergenic
1048107867 8:131430982-131431004 GAAAGGAACAAGAGACAGTGAGG - Intergenic
1048299207 8:133239063-133239085 CGCTGGAACCAGAGGCTGTGCGG + Exonic
1048977595 8:139681673-139681695 ATAAGGAACAAGAGTCTCTGAGG + Intronic
1049332914 8:142064714-142064736 GGCTGGAGCAAGGGTCTGTAGGG + Intergenic
1050379526 9:5012248-5012270 GGATGGAAGAAGAGTAAGTATGG + Intronic
1050529019 9:6571658-6571680 GGATGGAACAAGATGCTGCAGGG + Intronic
1055308924 9:74958196-74958218 GGATGAAAAAATAGTGTGTGGGG - Intergenic
1057908284 9:98999107-98999129 GGATGGGACAGGAGTGGGTGGGG + Intronic
1060009440 9:120030644-120030666 AGTTTGAACACGAGTCTGTGAGG - Intergenic
1060374654 9:123107462-123107484 GGTTGGAACCACAGTCTGAGTGG - Intergenic
1187351343 X:18520723-18520745 GGAGGAAACAAGAGTTGGTGAGG - Intronic
1188082395 X:25860359-25860381 GCCTGGAACTTGAGTCTGTGAGG - Intergenic
1192027254 X:67466703-67466725 GAAGAGAACAAGAGTCTGTCTGG + Intergenic
1192032043 X:67524303-67524325 GGATAGAACAAGAAATTGTGGGG + Intergenic
1193792182 X:85828242-85828264 GAATGGAACAACAGTCACTGGGG + Intergenic
1195021261 X:100831120-100831142 GGATGGAATAGCAGTCTGTAAGG + Intronic
1197862913 X:130988941-130988963 GGATGAAAGAAGAATCAGTGAGG + Intergenic
1197924106 X:131628476-131628498 GTAAGGAAGAAGAATCTGTGAGG - Intergenic
1198041855 X:132860410-132860432 GGATGCACAAAGACTCTGTGTGG - Intronic
1199326199 X:146501535-146501557 GGAAGGAACAAGAGTAGGTAGGG - Intergenic
1200063300 X:153493253-153493275 GAATGGAACCAGAGGCTCTGCGG + Intronic
1201714891 Y:17033615-17033637 GGATGGTATAAGGGACTGTGGGG - Intergenic