ID: 1092987895

View in Genome Browser
Species Human (GRCh38)
Location 12:13864752-13864774
Sequence ACATTAACGCAGGAGAGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092987891_1092987895 17 Left 1092987891 12:13864712-13864734 CCAGTGTCAAGTGGCAATTAGTC 0: 1
1: 0
2: 0
3: 4
4: 59
Right 1092987895 12:13864752-13864774 ACATTAACGCAGGAGAGGCTAGG 0: 1
1: 0
2: 0
3: 9
4: 102
1092987890_1092987895 18 Left 1092987890 12:13864711-13864733 CCCAGTGTCAAGTGGCAATTAGT 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1092987895 12:13864752-13864774 ACATTAACGCAGGAGAGGCTAGG 0: 1
1: 0
2: 0
3: 9
4: 102
1092987889_1092987895 19 Left 1092987889 12:13864710-13864732 CCCCAGTGTCAAGTGGCAATTAG 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1092987895 12:13864752-13864774 ACATTAACGCAGGAGAGGCTAGG 0: 1
1: 0
2: 0
3: 9
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092987895 Original CRISPR ACATTAACGCAGGAGAGGCT AGG Intronic
902315501 1:15615762-15615784 ACATAGATGCAAGAGAGGCTAGG - Intergenic
905271949 1:36793075-36793097 GCATTAGCCAAGGAGAGGCTGGG + Intergenic
906844145 1:49172551-49172573 ACTTTAACAAAGGAGAGGCTGGG + Intronic
907463119 1:54617619-54617641 ACATTAAAGTTGGAGAAGCTGGG - Intronic
910498259 1:87858048-87858070 AAAATAACATAGGAGAGGCTGGG + Intergenic
915661600 1:157409921-157409943 ACATTACTCCAGGACAGGCTAGG + Intergenic
920997319 1:211007491-211007513 ACATGAGGGCAGGAAAGGCTAGG - Intronic
924441142 1:244086441-244086463 ACAATAAGACAGGAGAGGGTGGG - Intergenic
1063194027 10:3723226-3723248 ACATGAGGGCAGGAGAGGGTCGG + Intergenic
1073111198 10:101063899-101063921 ACAGGCACGCAGGAAAGGCTGGG + Intronic
1080827462 11:35860228-35860250 ACATTAAGCCAGGAGAAGCAGGG - Intergenic
1081864503 11:46352226-46352248 ACTTTAAGGCAGGAGAGAATTGG + Intronic
1084929874 11:72546543-72546565 ACCTAAATGCAGGAGAGCCTGGG - Intergenic
1085992270 11:81863540-81863562 ATATTAATGAAAGAGAGGCTTGG - Intergenic
1086313942 11:85569325-85569347 ACATTAAGAAAGAAGAGGCTGGG - Intronic
1088079056 11:105888178-105888200 ATAATAAAGCAAGAGAGGCTGGG - Intronic
1088620311 11:111675043-111675065 ACATTATCACAGTAGAGGCTGGG - Intronic
1092143798 12:6201076-6201098 ACTTTTACGCAGGAGCGGCAGGG + Intronic
1092987895 12:13864752-13864774 ACATTAACGCAGGAGAGGCTAGG + Intronic
1093973347 12:25394658-25394680 ACATAAATGCATGAGAGGCCAGG + Intergenic
1094024166 12:25944990-25945012 ACAGTTAAACAGGAGAGGCTGGG + Intergenic
1098730792 12:74035299-74035321 ACATTAAATCAGGAGAGACCAGG - Intergenic
1099117172 12:78642223-78642245 ACATAACTGCAAGAGAGGCTGGG + Intergenic
1108003426 13:45925124-45925146 AATTTGAAGCAGGAGAGGCTTGG - Intergenic
1110096739 13:71533932-71533954 ACATAAACACATGAGAAGCTTGG + Intronic
1112265581 13:97920377-97920399 CTATTAACACAGGTGAGGCTGGG - Intergenic
1114903171 14:27091150-27091172 TCATTAGCGTAGGATAGGCTAGG - Intergenic
1115716745 14:36113954-36113976 ACATTAATGCAGGAATGGCTTGG + Intergenic
1117194741 14:53328592-53328614 ACCTTCACGCTGAAGAGGCTAGG - Intergenic
1117311476 14:54528034-54528056 ACATTAAAGAAGAACAGGCTGGG - Intronic
1117957324 14:61132741-61132763 ACATAAATCCAGGTGAGGCTAGG - Intergenic
1119187413 14:72652496-72652518 AAATTAAGGCAGGAGAAGCAGGG + Intronic
1120625310 14:86818450-86818472 ACATTAGAGCAGATGAGGCTAGG - Intergenic
1122616028 14:103018634-103018656 ACACCAAAGCAGGAGAGGCCAGG + Intronic
1129426096 15:75464148-75464170 ACACTAAAACTGGAGAGGCTGGG + Exonic
1129706350 15:77796696-77796718 AAAAAAAGGCAGGAGAGGCTGGG - Intronic
1131139726 15:89967408-89967430 ACATTAAAAAAGAAGAGGCTGGG + Intergenic
1132829301 16:1919601-1919623 TCATTAACGCAGCAGAGCCCAGG - Intergenic
1139512330 16:67434559-67434581 AGATTAAGGAAGGAGAGGCCTGG + Intronic
1141246985 16:82317031-82317053 ATATTAAGGCAGAATAGGCTGGG + Intergenic
1143188634 17:5025167-5025189 ACATGAAAGCAGGGGAGGCCGGG - Exonic
1144461167 17:15459739-15459761 AAATGAACTCAGTAGAGGCTGGG - Intronic
1146321957 17:31853859-31853881 ACAATAACGGAGGAAAGACTGGG + Intronic
1149855872 17:60082145-60082167 ACTTTGAACCAGGAGAGGCTAGG + Intergenic
1150593499 17:66583557-66583579 ACATTAACCCAGGAGTTGTTTGG - Intronic
1152594181 17:81230272-81230294 ACATTAAGGCAGCGGAGTCTGGG + Intronic
1158696835 18:59711057-59711079 ACATTAAAGCAGGCTAGGCATGG + Intergenic
1164512448 19:28908685-28908707 ACAATAAAGCAGCAGAGGCTTGG - Intergenic
1165669920 19:37667364-37667386 ACAGTAACTCAAGACAGGCTGGG - Intronic
1166346792 19:42171472-42171494 ACTTTAATGCAGGAGTGACTTGG + Intronic
1167747618 19:51361682-51361704 AAAAAAACCCAGGAGAGGCTGGG - Intronic
925365302 2:3307341-3307363 ACATTAGGGCAGGAGCCGCTGGG - Intronic
926665250 2:15514921-15514943 GCATGAACGGAGGAAAGGCTGGG - Intronic
928236188 2:29543318-29543340 ACATTTAAACAGGAGAGACTAGG + Intronic
929093470 2:38242372-38242394 ACATTGCTGCAAGAGAGGCTGGG - Intergenic
934061052 2:88293968-88293990 ACTTTAAGGGAGGGGAGGCTAGG - Intergenic
938957348 2:136310735-136310757 AAATTAAGGCAGGAGAAGCTTGG + Intergenic
944888033 2:204085091-204085113 ACATGAATGCGGGAGAGGCTGGG + Intergenic
945259236 2:207829111-207829133 ACATTAAAGCAGGAGACAGTGGG + Intronic
946843631 2:223840265-223840287 ATATTAAAGCAGGAAAGGCCAGG + Intergenic
1169307583 20:4505741-4505763 ACCTAAAGGCAAGAGAGGCTGGG + Intergenic
1170019012 20:11814910-11814932 ACACTAATGCATGTGAGGCTGGG + Intergenic
1172438980 20:34952111-34952133 ACAGTAAGGAAGCAGAGGCTTGG + Intronic
1172475176 20:35231759-35231781 ACATTAAAGCAGGCCAGGCATGG + Intronic
1178049453 21:28732062-28732084 ACAAAACGGCAGGAGAGGCTGGG - Intergenic
1178870600 21:36371431-36371453 ACTTTAAGGCAGGTTAGGCTAGG - Intronic
1180060008 21:45379934-45379956 AGATAAACACGGGAGAGGCTGGG - Intergenic
1184448451 22:44568244-44568266 ACATTAAGGCAGCAGAAGCAGGG + Intergenic
949487660 3:4555215-4555237 ACCTTAAAGCAGGAGAGGCAGGG - Intronic
952105791 3:30067943-30067965 TCTTTCAAGCAGGAGAGGCTGGG + Intergenic
954203291 3:49038495-49038517 ACTTGAACCCAGGAGAGGCGGGG - Intronic
954448304 3:50558282-50558304 ACAGTGACGGTGGAGAGGCTGGG + Exonic
955987939 3:64594598-64594620 CCATTAAAGTAGGAGAGTCTTGG - Intronic
961035233 3:123637456-123637478 ACAATAATGCAGGAGAGGGGAGG - Intronic
962359579 3:134726581-134726603 ACATCAGCCCAGGAGATGCTAGG + Intronic
964086807 3:152828547-152828569 ACATTAACGCAAGACAAGTTTGG + Intergenic
966627869 3:182037939-182037961 AAATAAAAGCAAGAGAGGCTGGG - Intergenic
969334719 4:6500934-6500956 ACATCCACACAGGAGAGGCAGGG + Intronic
970315668 4:14826400-14826422 ACTTTAAAGAAGGAGAGGCCAGG - Intergenic
976189995 4:82478348-82478370 ACATTTACACAGGTGAGGTTTGG - Intergenic
977817301 4:101429670-101429692 ACTTTGAGGGAGGAGAGGCTGGG + Intronic
986086915 5:4461212-4461234 CCATTAATGAAGGGGAGGCTGGG + Intergenic
987210925 5:15682338-15682360 ACATCACTGCAAGAGAGGCTAGG + Intronic
993584789 5:89710981-89711003 ACAGTAACAAAGGAGGGGCTGGG + Intergenic
1000123454 5:158220386-158220408 ATACTAACCCAGGAGGGGCTTGG + Intergenic
1001053755 5:168432849-168432871 AAATGGAGGCAGGAGAGGCTCGG - Intronic
1001250115 5:170140643-170140665 ACATTAAGCCAGGAGAAGCAGGG - Intergenic
1003487590 6:6592899-6592921 TCATAAAGGCAGGAGAGGTTAGG + Intronic
1004163265 6:13233160-13233182 GTATTCAGGCAGGAGAGGCTGGG - Intronic
1012335668 6:98053450-98053472 TCAGAAAAGCAGGAGAGGCTGGG - Intergenic
1012442385 6:99272632-99272654 AAATAAAAGCAGGAGAGGATGGG + Exonic
1012663638 6:101937693-101937715 ACATTAACAAAGTAGAGTCTGGG - Intronic
1024035112 7:45501370-45501392 AAATTAACCCAGTACAGGCTGGG + Intergenic
1027959359 7:84924523-84924545 ACATTTAGGCAGGTGGGGCTAGG + Intergenic
1029311257 7:99667225-99667247 ACATACACTCAGAAGAGGCTAGG - Intronic
1029657105 7:101934559-101934581 TCTTTAACTCATGAGAGGCTCGG - Intronic
1030303984 7:108001880-108001902 AGATGAGCGCAGGAGAGGCTGGG + Intronic
1031693123 7:124815669-124815691 ACATTAAAGCAAGGGTGGCTGGG + Intergenic
1033174894 7:139114680-139114702 ACATGACCACAGGTGAGGCTGGG + Intergenic
1035716046 8:1755652-1755674 TCATCCCCGCAGGAGAGGCTGGG - Intergenic
1039019234 8:33186827-33186849 AAATTAACTCAGGAGAGACCAGG + Intergenic
1040317511 8:46272691-46272713 ACAATACCGCAGGGAAGGCTGGG + Intergenic
1041648621 8:60279801-60279823 ACCTAAACTCAAGAGAGGCTAGG - Exonic
1047276192 8:123407426-123407448 ATAATAAGGCAGTAGAGGCTGGG + Intronic
1049572810 8:143377624-143377646 CCCTGAACGCAGCAGAGGCTGGG - Intronic
1060931712 9:127493355-127493377 TCAAAACCGCAGGAGAGGCTAGG - Intronic
1061939367 9:133875822-133875844 ACATTACCTCCGGAGTGGCTGGG + Intronic
1186739529 X:12502854-12502876 ACATTCACCCAGGAGAGTCCTGG + Intronic
1188895273 X:35659473-35659495 CAATTAAAGCAGGAGAAGCTGGG + Intergenic
1191670112 X:63740948-63740970 CCACTAACCCAGGAGAGGATGGG + Intronic
1194821472 X:98511984-98512006 ACAGAAATGCAGGAGAGGCTTGG + Intergenic
1197325791 X:125091690-125091712 ACATAAACCTAGGAGAGGCCGGG + Intergenic