ID: 1092990216

View in Genome Browser
Species Human (GRCh38)
Location 12:13890166-13890188
Sequence GTTTCAACACAGATGAAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 254}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092990214_1092990216 15 Left 1092990214 12:13890128-13890150 CCTATCTCGTTTCATGGACAATA 0: 1
1: 0
2: 1
3: 3
4: 91
Right 1092990216 12:13890166-13890188 GTTTCAACACAGATGAAGAATGG 0: 1
1: 0
2: 0
3: 18
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092990216 Original CRISPR GTTTCAACACAGATGAAGAA TGG Intronic
900964721 1:5949981-5950003 TTTTAAACACAGAAGAAAAATGG + Intronic
901156369 1:7142312-7142334 GTTCCAGCACAGAGGAAAAAAGG - Intronic
902855114 1:19197201-19197223 GTTCCAACACAGGTAGAGAAAGG + Exonic
904206263 1:28857143-28857165 TTTTCTTCACAGGTGAAGAATGG - Intronic
906552361 1:46675671-46675693 GATGCAACAGAGCTGAAGAATGG - Exonic
910545206 1:88408106-88408128 ATTTTTACACAGATGAAGGAGGG + Intergenic
911238372 1:95437010-95437032 GTTTTAACACAAGAGAAGAATGG - Intergenic
912786930 1:112613250-112613272 TTTTTAACACAAATGAACAATGG + Intronic
913211530 1:116586702-116586724 GTTTCAGTACAAATGAGGAAAGG + Intronic
913373736 1:118129094-118129116 GCTCCTACACAGATGAAGGAAGG + Intronic
913717340 1:121549968-121549990 GTTTCTACACAAATGAAGCCAGG - Intergenic
914897866 1:151692948-151692970 GATGGGACACAGATGAAGAAGGG + Exonic
915277312 1:154798228-154798250 GTTTGAACAAACAGGAAGAAAGG + Intronic
916920169 1:169457865-169457887 ATTTCTAGAAAGATGAAGAAAGG - Intronic
917185533 1:172350498-172350520 GTATCACTACAGAGGAAGAAAGG + Intronic
917334901 1:173916693-173916715 GTGACAACTCAGATGAAGAAGGG + Intronic
917710781 1:177681845-177681867 GTTTCCAGGCAGATGGAGAAGGG + Intergenic
918987735 1:191654992-191655014 GTTCCAACACAGTTCAAGAATGG + Intergenic
919004352 1:191875641-191875663 GTTTCAACAAAAATGTTGAAGGG + Intergenic
919522579 1:198606685-198606707 GTTACAAGAGAAATGAAGAAAGG - Intergenic
920220686 1:204398113-204398135 CTTCCACCACAGAGGAAGAAAGG + Intergenic
920966167 1:210702814-210702836 GCTGCAGCACAGATGCAGAAGGG - Intronic
922071762 1:222201800-222201822 GTTTAGACACAATTGAAGAAAGG + Intergenic
924294981 1:242577470-242577492 GTTTCAACCCTGAAGGAGAAAGG - Intergenic
924805154 1:247356053-247356075 ATTTCGACACAGAGAAAGAAAGG + Intergenic
1063403422 10:5770073-5770095 GCTACAACACAGATGAACCATGG + Intronic
1063631394 10:7736990-7737012 CTTTCAACAAAATTGAAGAAGGG - Intronic
1064719121 10:18210410-18210432 CTTTGAACAAAGGTGAAGAATGG + Intronic
1064944041 10:20768313-20768335 GTCTCAGCACAGATCAGGAATGG - Intergenic
1065158975 10:22899462-22899484 ATTTGAACACAGATGCAGAGAGG + Intergenic
1065611953 10:27480521-27480543 ACTTCAGCACAGATAAAGAAGGG - Intergenic
1067280846 10:44871469-44871491 GTTTCAACTGAGAGGAAGAGTGG - Intergenic
1068778029 10:60888669-60888691 GTGTCGACCCAGAGGAAGAAAGG - Exonic
1071165194 10:82798259-82798281 GTTCCAATACAGAAGAATAAAGG + Intronic
1071222256 10:83482477-83482499 GATTCAACTCATATGAAAAATGG - Intergenic
1071288522 10:84171564-84171586 GTTTCCACCCAGATGGAGTAGGG + Intergenic
1075192789 10:120326415-120326437 GTTTCATCACAGATCAAGTGAGG + Intergenic
1077820629 11:5736401-5736423 ATTTCTAAAGAGATGAAGAAAGG + Intronic
1078820697 11:14878129-14878151 CTTTCAGCACAGATGAGGTAGGG + Exonic
1078863676 11:15276818-15276840 GTGTGAACACAAATGAAAAAGGG + Intergenic
1079857538 11:25624836-25624858 GTCTCAACAGAAATGAACAAAGG + Intergenic
1080332744 11:31158595-31158617 GTTTCAAGAAAGATTAAAAATGG - Intronic
1085688035 11:78642813-78642835 GTTTCAATACAGAGGAGGGAGGG - Intergenic
1085811702 11:79688475-79688497 TTCTCATCACAGATGAGGAAGGG + Intergenic
1086471756 11:87121047-87121069 GTTTCAGCAAAGTGGAAGAAGGG + Intronic
1088129450 11:106470021-106470043 CTTTCAACAAACATGAAAAATGG + Intergenic
1089022996 11:115237444-115237466 ACTTCAACACAGCTGTAGAAGGG - Intronic
1089032065 11:115341761-115341783 GTTCAAAAACAGATGAAAAAAGG - Intronic
1090480209 11:127061286-127061308 ATTTAAACCAAGATGAAGAAAGG - Intergenic
1090640659 11:128726454-128726476 GTGTCATCAAAGATGAAGACTGG + Intronic
1091381644 12:66099-66121 GTTTCGTCACGGATGAAGGAAGG + Intergenic
1091760715 12:3085422-3085444 GTTTCAACGCAGATGCACAGAGG - Intronic
1092872416 12:12817744-12817766 GTTTCTTCAGAGATGAAGAAAGG + Intronic
1092990216 12:13890166-13890188 GTTTCAACACAGATGAAGAATGG + Intronic
1095153658 12:38825790-38825812 GTTCCAACGCAGGTGAACAATGG - Intronic
1095900615 12:47324499-47324521 TTTTCAAAAGAGATGAAGTAAGG - Intergenic
1097670690 12:62533918-62533940 GTTCCAACACTGTTGGAGAAGGG - Intronic
1098187680 12:67915591-67915613 CTTTCTACACAGAAGAACAAAGG - Intergenic
1098368640 12:69734344-69734366 GTTCTAACACTAATGAAGAAGGG - Intergenic
1098941774 12:76545580-76545602 ATTTCAATACAGACTAAGAATGG + Intronic
1100511137 12:95275202-95275224 GTTTCAACAAACATGGATAATGG + Intronic
1100541328 12:95560351-95560373 TTTTGAGCACAGAGGAAGAAAGG + Intergenic
1100672058 12:96824195-96824217 GCTGCCACAGAGATGAAGAAGGG - Intronic
1100752216 12:97710931-97710953 GTTTCAACATAAATGTTGAAGGG + Intergenic
1102822762 12:115922354-115922376 GCTTCAACACAGCAGAAGCAAGG + Intergenic
1102892324 12:116569648-116569670 ATTTCAACAAAGAAGTAGAATGG + Intergenic
1103119569 12:118370393-118370415 GTTTCAACTAAGAGGAATAAAGG - Intronic
1104105729 12:125657207-125657229 GTTTTAACACAGAGGAGCAAAGG - Exonic
1104147397 12:126048519-126048541 CTTACAACATAGATGAAGCAAGG + Intergenic
1104560980 12:129844178-129844200 ATTTCAACACATCTGAAGAGGGG + Intronic
1108301701 13:49083796-49083818 GTATGAACACATATGAAGATGGG - Intronic
1108348613 13:49569969-49569991 CTTACAAAACAGATGGAGAAAGG + Intronic
1109609376 13:64743345-64743367 ATTTTAACAGAAATGAAGAATGG - Intergenic
1110421331 13:75312886-75312908 CTTTCAACAGTGATGGAGAAGGG - Exonic
1114913962 14:27238439-27238461 GTTTAAAGACAGATAAGGAAAGG + Intergenic
1115448665 14:33520790-33520812 GTTTCAACACAGCTGTTGAGTGG + Intronic
1115705060 14:35990187-35990209 GTTTGAACAGAGATTAAGGATGG + Intergenic
1116184025 14:41573287-41573309 GATTGAACCCACATGAAGAAGGG - Intergenic
1116639538 14:47443444-47443466 GCTTCAAAACAGATGAGAAATGG + Intronic
1118247989 14:64130327-64130349 ATTTCAACAAAGAAGAAAAATGG - Intronic
1118493823 14:66288209-66288231 CTTTCAACACAGATGCAAAAGGG - Intergenic
1118652514 14:67912626-67912648 GTGAGAACACAGAGGAAGAAGGG + Intronic
1118793358 14:69116335-69116357 GTTTTAACACCTATGAATAAAGG + Intronic
1120119542 14:80662142-80662164 GTTGAAACACTGATGAAAAATGG + Intronic
1120452839 14:84691973-84691995 GTTTCATCGGAGATCAAGAATGG + Intergenic
1123679762 15:22753504-22753526 GCTACAAAACAGATGAAAAAAGG - Intergenic
1124331977 15:28827979-28828001 GCTACAAAACAGATGAAAAAAGG - Intergenic
1130858062 15:87859097-87859119 AGTTCAACAGAGATGTAGAAAGG - Intergenic
1131547282 15:93326412-93326434 ATTTCAGCGAAGATGAAGAAGGG - Intergenic
1131647309 15:94359442-94359464 ATTTAAACACAGATGTTGAAAGG + Intronic
1131743899 15:95424024-95424046 GTACCCACACAGATGAAGAGTGG + Intergenic
1132215727 15:100060392-100060414 GTGTCCACAGAGAGGAAGAAGGG - Intronic
1133694304 16:8246254-8246276 CTTTCAGCACAGTAGAAGAAAGG + Intergenic
1134013766 16:10874322-10874344 GTTTCAACAGAGAGGAAGCCTGG + Intergenic
1134190422 16:12116748-12116770 GCTTCAACACAGATGAACCGTGG + Intronic
1134428662 16:14179309-14179331 GTTTCAACAGAGAAAAGGAATGG - Intronic
1134438514 16:14283365-14283387 GTTTCAACACAAAGGAAAAGTGG + Intergenic
1137550745 16:49435860-49435882 ATTTCAAGAAAGCTGAAGAAAGG + Intergenic
1138148163 16:54630934-54630956 ATATCAACATAGATAAAGAAAGG + Intergenic
1139157351 16:64459742-64459764 TTTTCAACAAATATGAATAATGG + Intergenic
1141848206 16:86625770-86625792 TGTTTTACACAGATGAAGAAAGG + Intergenic
1145802656 17:27699233-27699255 GATTCCACACAGATGATCAACGG + Intergenic
1147566254 17:41538046-41538068 GTTCCAACACAGATCTAGGAGGG - Intergenic
1148877592 17:50699740-50699762 GATTCAGCCCAGATGCAGAATGG - Exonic
1150534998 17:66028279-66028301 ATTTCTACACAGAAGAACAATGG - Intronic
1150626328 17:66843589-66843611 GTTTAAACACAGGGGAAGATGGG - Intronic
1153906365 18:9665245-9665267 GTTTCTAAACAGCTGGAGAAAGG + Intergenic
1155214315 18:23629716-23629738 TTTTCATCACAGAAGCAGAAGGG + Intronic
1155662664 18:28269539-28269561 ATTATAACACAGATAAAGAAGGG - Intergenic
1156178265 18:34573184-34573206 TTTTAAACACAGAGGAATAAAGG - Intronic
1156786029 18:40916435-40916457 TTTTCAACAGAGATTGAGAAGGG + Intergenic
1158738514 18:60112250-60112272 GGTCGAACATAGATGAAGAATGG + Intergenic
1158826472 18:61225699-61225721 TTTACTACACAGAGGAAGAAAGG + Intergenic
1159587032 18:70290772-70290794 GTTTCAAAAGAGATGCTGAATGG - Intronic
1159975872 18:74711470-74711492 GTTTCAAGATTGAGGAAGAAGGG + Intronic
1161145730 19:2677064-2677086 GTGTCACCACAGAGGAAAAACGG + Intronic
1164676387 19:30104375-30104397 TTTTCAGCACAGCTGAAGAAGGG + Intergenic
1166408929 19:42543390-42543412 GTTTCAACACAGCCACAGAAGGG - Intronic
1166731106 19:45059528-45059550 GTTTCTGCACAGATGAAGTGGGG - Intronic
925801287 2:7604532-7604554 TTTTAAACACAGAGAAAGAAGGG + Intergenic
926688950 2:15719555-15719577 GTTTCCACGCAGGGGAAGAAAGG - Intronic
927694963 2:25233332-25233354 GTTTCACCAAGGATGGAGAAAGG - Exonic
929872409 2:45770298-45770320 GTTTCCAGACAGAGGAAGCATGG - Intronic
929929851 2:46245229-46245251 TTTTCAACAAAGGTAAAGAAAGG - Intergenic
931829086 2:66032020-66032042 GTCTCTACATAGAAGAAGAAAGG + Intergenic
931905912 2:66843887-66843909 TTTTCAGCTCAGATGATGAAAGG + Intergenic
933396986 2:81745016-81745038 AATTCAACACAGATAAACAATGG - Intergenic
934865799 2:97809344-97809366 CTTCCAACAGAGATGGAGAAGGG - Intronic
934885090 2:98017347-98017369 GTTTCAAAGCAGAGGAAGTAGGG + Intergenic
935525768 2:104164668-104164690 GTGTGAAGACAGAGGAAGAAAGG - Intergenic
938591859 2:132747226-132747248 GGTTGAACACAGATGAGCAAAGG + Intronic
939274143 2:139978205-139978227 GATTGAACCCAGGTGAAGAAAGG + Intergenic
941461430 2:165776911-165776933 GTTTAAACACAAATTGAGAAGGG + Intronic
942482981 2:176409007-176409029 GTTTCAATACAGATAAAAAGGGG - Intergenic
942825211 2:180167481-180167503 GTTTCCAAACAAATGAGGAATGG - Intergenic
944957943 2:204834036-204834058 GTGTCATCCCAGGTGAAGAATGG - Intronic
945986199 2:216355819-216355841 TTTTTAACACAGAAGAAAAAAGG - Intronic
946842745 2:223834938-223834960 GATTGAACACAGATGCAGATAGG - Intronic
947673241 2:231955265-231955287 GTTACAACAGATATGAAAAATGG - Intergenic
948744430 2:240076346-240076368 TTTTCAAGAAAGATGAAGACAGG + Intergenic
948997077 2:241586738-241586760 AATTAGACACAGATGAAGAAAGG + Intronic
949048244 2:241882066-241882088 GTTTCAACACAGCTGAGGCCTGG + Intergenic
1170674911 20:18470039-18470061 GTTTCTGGACAGATGGAGAATGG - Intronic
1171510006 20:25674540-25674562 GTTTCAACATAAATTAAGGAGGG + Exonic
1172307843 20:33894235-33894257 GTTTCATCTCAGGTGATGAATGG + Intergenic
1173446613 20:43124703-43124725 TTTTCTACACGGATGTAGAAAGG - Intronic
1175083729 20:56442135-56442157 CTGTCAACACAGATATAGAAAGG - Intronic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1176283562 20:64328734-64328756 GTTTCGTCACGGATGAAGGAAGG - Intergenic
1177091447 21:16774131-16774153 GTTTCAGAACAGATAATGAAGGG - Intergenic
1177414635 21:20777877-20777899 TTTTTAACAAAGATGAAGACTGG - Intergenic
1177495305 21:21881616-21881638 GTTTCAACACAGATACTGGAAGG + Intergenic
1177843207 21:26257509-26257531 TTTGCAACACAAATGATGAAAGG - Intergenic
1178448121 21:32663930-32663952 GTCTATACACAGATGATGAAGGG + Intronic
1180684878 22:17658145-17658167 GCTTAAAGAGAGATGAAGAAAGG - Intronic
1180865771 22:19118847-19118869 TTCTCTACACAGATGGAGAAAGG + Intronic
949108322 3:226885-226907 TTTTCAAAACAGAATAAGAAGGG + Intronic
951086160 3:18515249-18515271 TTTGCAACACAGTTAAAGAAGGG - Intergenic
951871599 3:27368488-27368510 GATTCAACACCTATTAAGAAGGG + Intronic
952202047 3:31139860-31139882 GATTCCACACAGATGTAAAAAGG + Intergenic
952358948 3:32610692-32610714 GTTACAAACCATATGAAGAATGG + Intergenic
955928087 3:64027648-64027670 CTTGCAACACAGATAAAAAAAGG - Intergenic
956142428 3:66159301-66159323 ATTTCAACCCTAATGAAGAAAGG + Intronic
956368827 3:68536013-68536035 GTCTCAAAACAGAGGAAGCAGGG + Intronic
957957866 3:87211829-87211851 TTATGAACATAGATGAAGAAAGG - Intergenic
958013138 3:87906265-87906287 GTATCAATACAGATAAAGAAGGG - Intergenic
958103570 3:89045646-89045668 GTTACAACACATATGAAGATTGG - Intergenic
960880025 3:122334766-122334788 GTTGGAAAACAGATGAACAATGG + Intronic
964215513 3:154276110-154276132 ATTTAAACAATGATGAAGAATGG + Exonic
964920118 3:161885790-161885812 GTTTCATCTGAGATAAAGAAAGG - Intergenic
967800209 3:193649718-193649740 GTTTCACCACTGAGGAAGAAAGG - Intronic
970768030 4:19574791-19574813 GATACAACACAAATGAATAATGG - Intergenic
971768923 4:30871076-30871098 TTTTAAAAACAAATGAAGAAGGG - Intronic
972197089 4:36666732-36666754 GCTTCAACACACTTCAAGAAGGG - Intergenic
974065214 4:57071410-57071432 TTGTCAGCACAGATAAAGAAAGG - Intronic
975060081 4:69986138-69986160 GGTTGCACACAGATGAATAAGGG + Intergenic
976570647 4:86605336-86605358 GTTTCAAAACAGATGAAAGTTGG + Intronic
976969634 4:91089848-91089870 GTTTCCACATAGATGATCAAGGG - Intronic
977098753 4:92780625-92780647 GTTTCAATCCTTATGAAGAAAGG + Intronic
977158274 4:93601699-93601721 GTTTAAAGACAGAGGAACAAAGG - Intronic
977257451 4:94757310-94757332 GTTTCAAAAAATATGTAGAAGGG + Intergenic
978997068 4:115169987-115170009 ATTTCAACACAGAGGCACAAAGG - Intergenic
979700533 4:123661497-123661519 GTTTCATCACACATAAAGAATGG + Intergenic
980089229 4:128424695-128424717 GTTTCAACACAGATAAATTATGG + Intergenic
980418227 4:132521336-132521358 GTTTCATCATACTTGAAGAATGG - Intergenic
980868576 4:138583510-138583532 GTTATAACACAGATGTGGAAGGG - Intergenic
984880597 4:184406833-184406855 GTTTCACCATAGATAAAGACAGG + Intronic
985831392 5:2235354-2235376 AGATCAAAACAGATGAAGAAGGG - Intergenic
986390729 5:7285299-7285321 GCTACAAAACAGATGAAAAAAGG - Intergenic
986545548 5:8892667-8892689 GTTTCCATACAGAGGAAGGAGGG - Intergenic
990558761 5:56963054-56963076 TTTACAACACAGATTAGGAAAGG - Intronic
991068934 5:62455638-62455660 ATTTTAACACAGAGGAGGAAAGG - Intronic
991446377 5:66704433-66704455 CTTTCAACAGAGATGAAGGATGG - Intronic
991929025 5:71733447-71733469 GTCTCAACACAAATGAACTAAGG - Intergenic
993636360 5:90349067-90349089 TCTTCAGCACAGATGAAGGAAGG - Intergenic
994154192 5:96484393-96484415 ATTTAAAAACAGATGTAGAAGGG - Intergenic
994549776 5:101217521-101217543 GTTCCCACACAGAGAAAGAAGGG + Intergenic
995010381 5:107250940-107250962 GTTTAAACATACATGAAGAGTGG + Intergenic
995380517 5:111527146-111527168 GTTTCATCACAGATGATAAAAGG - Intergenic
997074875 5:130661899-130661921 TTTTGAACCCAGATGAAGACAGG + Intergenic
997397200 5:133571777-133571799 GATTAAACACAACTGAAGAAAGG + Intronic
999912114 5:156213573-156213595 CTTTCAAAAAAGCTGAAGAAGGG + Intronic
1000464423 5:161558042-161558064 GTTTCTACAAAGAGGAGGAATGG + Intronic
1000712595 5:164599620-164599642 GTTCCAAAACGGCTGAAGAAAGG - Intergenic
1002585797 5:180246614-180246636 GTTAAAACACAAATGAAAAAGGG + Intronic
1002694018 5:181071979-181072001 GTTTCAACACATATCAAGGATGG + Intergenic
1004177376 6:13351444-13351466 TTTTCAACACGGAGGATGAAAGG + Intergenic
1004335354 6:14759423-14759445 GTTTCAACATCCATAAAGAAAGG + Intergenic
1004422781 6:15486691-15486713 GTGACAACAGAGATGAAGAAAGG - Intronic
1004982778 6:21045099-21045121 GTTTCAACATAGATTTTGAATGG + Intronic
1004984953 6:21070997-21071019 GATTAAAAACAAATGAAGAAAGG - Intronic
1006295999 6:33170392-33170414 GATACACCACAGATGAGGAAGGG + Intronic
1008622191 6:53281518-53281540 ATTCAAAAACAGATGAAGAAGGG - Intronic
1008768660 6:54951654-54951676 TTTTCAACAGAGATGTAAAATGG + Intergenic
1009732682 6:67630357-67630379 GTTTTAGCACAGAACAAGAATGG - Intergenic
1012063885 6:94522394-94522416 ATTTCAACACTGAAGATGAATGG - Intergenic
1013048357 6:106509860-106509882 GTTACCACACAGATGAGGAAAGG - Intergenic
1015154034 6:130071036-130071058 GTAGCAACACAGATGAATGAGGG - Exonic
1015639536 6:135316210-135316232 GGTTGAAGACAGATAAAGAAAGG - Intronic
1018498553 6:164377541-164377563 ATTTCAAAACAGATGCGGAAGGG - Intergenic
1018830477 6:167438701-167438723 GTTTCAACACAGATGCACAGAGG - Intergenic
1019731954 7:2633461-2633483 GTTTCCTAACAGATGAGGAAGGG + Intronic
1021517800 7:21506487-21506509 ATTTCAACACAAAGAAAGAAGGG - Intronic
1022152851 7:27626912-27626934 GTTTCAAGACTGATGAACACTGG + Intronic
1022793405 7:33712032-33712054 GTTTCTACACAGATGCTGGAAGG - Intergenic
1024039617 7:45542138-45542160 TTGTCAGCACAAATGAAGAAGGG - Intergenic
1024350554 7:48358570-48358592 GTTTCTACATAGATGAATAGAGG - Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1028797621 7:94921960-94921982 GTTTCAAAAAAGAAAAAGAAGGG + Intronic
1030740134 7:113099669-113099691 GTTTAAACACAGATGGACTATGG + Intergenic
1032349832 7:131150886-131150908 CTTTCAAAATAAATGAAGAAGGG + Intronic
1032677935 7:134148935-134148957 GTTTCAGCAAATTTGAAGAAAGG - Intronic
1035926480 8:3733568-3733590 GTTTCATCACACTCGAAGAATGG - Intronic
1036372551 8:8173634-8173656 TCTTTAACACAGATGAAAAATGG + Intergenic
1036878352 8:12492007-12492029 TCTTTAACACAGATGAAAAATGG - Intergenic
1037259810 8:16995920-16995942 GTTTTATGACAGATGAAAAAAGG + Intronic
1038581946 8:28755429-28755451 ACGTCAAGACAGATGAAGAAAGG - Intronic
1038632526 8:29259879-29259901 TTTGCATCTCAGATGAAGAAAGG + Intronic
1039956653 8:42212586-42212608 GTTTTCTCAAAGATGAAGAAAGG + Intergenic
1040045099 8:42954833-42954855 GTTGTAACAGAAATGAAGAAAGG + Intronic
1041049867 8:53923988-53924010 ATTCCAAAACATATGAAGAAAGG - Intronic
1041761325 8:61369992-61370014 GTTTCAAATGAGATGAAGAGAGG + Intronic
1042566792 8:70119551-70119573 GTTTCTACCCAAAGGAAGAAAGG - Intronic
1042751244 8:72160214-72160236 GTTTCAACACAAATTTTGAATGG + Intergenic
1046733992 8:117756258-117756280 GTTTCAACTTAGAAGAAGTAAGG + Intergenic
1046800561 8:118422102-118422124 TTATCAACAGAAATGAAGAAAGG + Intronic
1047233932 8:123022210-123022232 GTTCCAACTCAAATTAAGAATGG + Intronic
1050180546 9:2917953-2917975 GTTTCAAAAAAAAAGAAGAAGGG - Intergenic
1050290729 9:4151663-4151685 CTTAGAACAAAGATGAAGAAAGG - Intronic
1051114789 9:13682373-13682395 GTTTCACCACAAATGACAAAGGG - Intergenic
1051509791 9:17864770-17864792 GTCACAATATAGATGAAGAAAGG - Intergenic
1054523887 9:66100662-66100684 GCTGCAACACAGATGCAGCATGG + Intergenic
1055170460 9:73252403-73252425 ATTTCAACAAAGATATAGAAGGG + Intergenic
1055342489 9:75299176-75299198 GTGTCCACACAGATGAAGCATGG - Intergenic
1056194776 9:84218752-84218774 GTTTCAACAGAGAGCAAGAGCGG + Intergenic
1059061178 9:111037325-111037347 ATTTCAACAAAAATGAAGAGAGG + Intronic
1059094288 9:111395866-111395888 CTTTGAACACACATGAAGCAAGG - Intronic
1059861907 9:118473944-118473966 TTTTAAACACACATAAAGAAAGG + Intergenic
1059914323 9:119082117-119082139 GTGTCAGCAAAGATGAAGAGGGG + Intergenic
1185869085 X:3649023-3649045 GTTTAAAGACAGATGTATAAAGG + Intronic
1188139904 X:26537076-26537098 GCTTCAAAAGAGATGAAGAAGGG - Intergenic
1188218859 X:27514730-27514752 GTGGCAACACAAATGAACAATGG + Intergenic
1188944738 X:36285492-36285514 TTGTCAAGACAGCTGAAGAAAGG - Intronic
1189050218 X:37637188-37637210 GTCTGAACACAGATGATGGAAGG - Intronic
1189308347 X:40004061-40004083 GCATAAAAACAGATGAAGAAAGG - Intergenic
1189716408 X:43871017-43871039 GGTTCAACATGTATGAAGAAAGG + Intronic
1190773151 X:53531799-53531821 GTTTTGTGACAGATGAAGAAAGG - Intergenic
1195568462 X:106372487-106372509 ATATCAAAAAAGATGAAGAAGGG + Intergenic
1196724914 X:118887172-118887194 ATTTTGACACAGAGGAAGAAGGG + Intergenic
1198364526 X:135927497-135927519 GTTACAATAGAGAGGAAGAAAGG + Intergenic
1198479206 X:137025468-137025490 GTTGTAGCACAGATGAAGAGGGG + Intergenic
1200328011 X:155263234-155263256 GTATGAACACAGAGGAGGAAAGG - Intronic
1201377518 Y:13339307-13339329 GTTTCAGCCCAGAAGGAGAATGG + Intronic