ID: 1092993791

View in Genome Browser
Species Human (GRCh38)
Location 12:13928425-13928447
Sequence CTAATTCAGAAGATATTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 676
Summary {0: 1, 1: 1, 2: 25, 3: 93, 4: 556}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092993791 Original CRISPR CTAATTCAGAAGATATTTAA AGG Intronic
900827372 1:4937607-4937629 CTCTTTCTGATGATATTTAAAGG + Intergenic
901827410 1:11871234-11871256 AGAATTTAGAAGATATTTAATGG + Intergenic
902481348 1:16713610-16713632 CTCATTCAGCAGATGTTTACTGG + Intergenic
902912607 1:19611669-19611691 CTACTTTAGAAGATGTTTTAAGG + Intronic
904182665 1:28677677-28677699 CAAATTTTGAAGATATTTATGGG + Intronic
904337373 1:29806877-29806899 CTCAGACAGAAGATATTTAATGG + Intergenic
904445039 1:30564885-30564907 CTAATTTGGAGGTTATTTAATGG + Intergenic
905682298 1:39882950-39882972 TTTATTCAAAAGATATTTACTGG + Intronic
906285581 1:44585591-44585613 CTTACTCAGCAGATATTTAGTGG + Intronic
906564146 1:46785092-46785114 CTAATTCAAAGCTTATTTAAAGG - Intronic
906741327 1:48188363-48188385 CTAATTCAGAAGTTATAAAGAGG - Intergenic
906829414 1:49015752-49015774 CTAATTCAAAGGATATAGAACGG - Intronic
908388383 1:63663495-63663517 CTCATTCTGAAAATATTTAATGG - Intergenic
908656887 1:66397681-66397703 CCAATTCTGAGGATAATTAATGG + Intergenic
908702333 1:66915690-66915712 CTAATTCAAAGTTTATTTAAAGG + Intronic
908805471 1:67926787-67926809 CTAGTTTAGAAGTTATTTAAAGG - Intergenic
909301444 1:74017819-74017841 CTAATACAGAGAATATTTACGGG - Intergenic
909496091 1:76280174-76280196 CTAATTCAGAACATAGCAAAGGG - Intronic
909586223 1:77291660-77291682 CTAATTCAACAAATATTTATTGG + Intronic
909871747 1:80748885-80748907 ATATTTAAGAAGATTTTTAAAGG - Intergenic
910039678 1:82834570-82834592 TTCATTCAACAGATATTTAATGG + Intergenic
910617137 1:89210935-89210957 CAAATTCAGAAGTTATCTAAAGG + Intergenic
911159059 1:94665488-94665510 CTAACTCAAAAGTTATTTAAAGG - Intergenic
911369060 1:96974597-96974619 ATAATTCAGCAGGTATTTCAAGG + Intergenic
911795697 1:102073018-102073040 ATAAATCAGAAGCTATTAAATGG + Intergenic
912032187 1:105262638-105262660 CTAATTCTGAAGAAAGTCAATGG + Intergenic
912238792 1:107882800-107882822 GTAATTCAGGGGATATTTGAAGG - Intronic
912495832 1:110090576-110090598 CTGATTCAGAAGTCATTTCATGG + Intergenic
912529926 1:110312848-110312870 TTAATTCAGCAAATATTTACAGG - Intergenic
912579603 1:110708239-110708261 TTAATTCAGAAAATATTTATTGG + Intergenic
912980985 1:114372148-114372170 CTAATTCAAAGCTTATTTAAAGG + Intergenic
913352967 1:117882733-117882755 CTAAATAAGATGAGATTTAATGG + Intronic
915427506 1:155839095-155839117 CTAATTCAAAAGTTATCTAAAGG + Intronic
915652627 1:157328651-157328673 CTAATTCAAAGCTTATTTAAAGG + Intergenic
916624371 1:166538566-166538588 CTAATTCAAAGCTTATTTAAAGG - Intergenic
917232153 1:172849569-172849591 CTAATTCAAAGCTTATTTAAAGG - Intergenic
917438981 1:175049620-175049642 TTAATTCCAATGATATTTAATGG + Intergenic
917692863 1:177486895-177486917 GAAACTCAGAAGATATTTCAAGG + Intergenic
918738021 1:188091468-188091490 CAAATTCAATAGATATTTAAAGG - Intergenic
918824846 1:189311361-189311383 CGATTGCATAAGATATTTAAAGG + Intergenic
918864684 1:189880171-189880193 CACATTCAGAAAATATTAAATGG + Intergenic
918966789 1:191361189-191361211 CTAACTCAGATGATAATAAAAGG + Intergenic
919186913 1:194162819-194162841 CAACATCAGCAGATATTTAAGGG + Intergenic
919235435 1:194835927-194835949 TTAATTTAGAAAATATTTTAAGG + Intergenic
919585414 1:199432466-199432488 GTAATTCAGAAGATTTCTAGTGG - Intergenic
920011337 1:202869883-202869905 CTAATTCAGAAGCCATCTAAGGG - Intergenic
921415021 1:214875968-214875990 CTATTTTGGAAGATATTTCATGG - Intergenic
922032979 1:221822226-221822248 CTAATTCAGTAGATGTTAGATGG - Intergenic
922083951 1:222327109-222327131 CTTATTCAGAGGAAATTTAATGG - Intergenic
923169463 1:231400368-231400390 CTGATTCAGAAGATCTGTAGTGG + Intronic
923294947 1:232585036-232585058 CCAATTGAGGAGATATATAATGG - Intergenic
924035087 1:239927861-239927883 CTAATTCAGAAATTATCTAAAGG - Intergenic
1063594503 10:7421722-7421744 CTGATTCATAAGATATTAAAAGG + Intergenic
1063768799 10:9174382-9174404 CCAATTCAGAATGTATTGAAAGG - Intergenic
1064358524 10:14641939-14641961 CTGATTTAGATGATATTTAAAGG - Intronic
1065398387 10:25266712-25266734 CTTATTCAAAATATATTTATTGG - Intronic
1065592159 10:27274895-27274917 CGAATTCTGCAGATATTAAAAGG - Intergenic
1065770886 10:29077334-29077356 CTAATTCAGCAAGTATTTATTGG - Intergenic
1066090449 10:32013509-32013531 CAAGATCAGAAGAGATTTAAGGG + Intronic
1066290436 10:34009423-34009445 AAAATTCAAAAGAAATTTAAAGG - Intergenic
1066396921 10:35034776-35034798 CAAATTCAGAGGATATGGAAAGG + Intronic
1067563716 10:47321890-47321912 CCCATTCAGAAGATAGTTATAGG - Intergenic
1068097423 10:52509625-52509647 CTAATTCAGAGGGTATCTAAAGG - Intergenic
1068228603 10:54139699-54139721 CTAGTTCAGAAGTTATCTAAAGG + Intronic
1068290692 10:54998129-54998151 CTAATTCACAAGTCATCTAAAGG + Intronic
1069174437 10:65272542-65272564 ATAATTAAGAACATATTCAAAGG + Intergenic
1069520871 10:69119677-69119699 CTAACACCAAAGATATTTAAGGG + Intergenic
1069803969 10:71105988-71106010 CAAATTCTAAAGATATTAAAAGG + Intergenic
1070694761 10:78553787-78553809 TTTCTTCAGAATATATTTAAAGG + Intergenic
1070997889 10:80802271-80802293 CAATTTCAGTAGATATTTAGTGG - Intergenic
1071270628 10:84003619-84003641 CTGTTTCTGGAGATATTTAAGGG - Intergenic
1072260780 10:93669609-93669631 GCAATTGAAAAGATATTTAAAGG + Exonic
1072433506 10:95394600-95394622 CTAAATCTGAAGGTAATTAAAGG - Exonic
1073738311 10:106376732-106376754 CTAATTCAAAGCCTATTTAAAGG + Intergenic
1074025864 10:109633812-109633834 CTAATTCAAAGCTTATTTAAAGG + Intergenic
1074632722 10:115275829-115275851 TTAATATAGAAGACATTTAATGG - Intronic
1075750247 10:124763152-124763174 TTACTTCAGAAGCAATTTAAGGG - Intronic
1077558865 11:3243268-3243290 CTAGTTTAGAGGCTATTTAAGGG - Intergenic
1077740919 11:4844098-4844120 CTGATACTGAAGAAATTTAAAGG + Intronic
1078889345 11:15539988-15540010 CTATTTCAGGAGCTATTTGATGG + Intergenic
1078920001 11:15821392-15821414 CTAATTCATAAGATATTGGGAGG - Intergenic
1079226797 11:18613893-18613915 CTTATTCAGCAGATATTTCTTGG - Intronic
1079420491 11:20282442-20282464 CTAGTTTAAAAGTTATTTAAAGG - Intergenic
1080065314 11:28004488-28004510 CTAATTCAGAGGTTATCTAAAGG + Intergenic
1080198619 11:29641646-29641668 CTAATTTATAATATATTTATTGG - Intergenic
1080293304 11:30696054-30696076 TTCATTCAAAAAATATTTAAGGG - Intergenic
1080344046 11:31301532-31301554 CAAATTCAGTAGACATATAATGG + Intronic
1080914093 11:36637605-36637627 CTAATTCAGAAGGTCTTTGGTGG + Intronic
1081163684 11:39783997-39784019 CCGTTTCAGAAGATATATAATGG - Intergenic
1081332031 11:41814392-41814414 CTTATTCAGAAGTTATTTGAAGG - Intergenic
1082227069 11:49720575-49720597 TTCATTCAGAAAATATTTATTGG - Intergenic
1082737131 11:56868593-56868615 CTAATTCAGAGCTTATTTAAAGG + Intergenic
1082950782 11:58813659-58813681 CTAATTCAAAGCTTATTTAAAGG + Intergenic
1083453495 11:62762321-62762343 TTCATTCAGAAGATATATAGAGG - Intronic
1084217362 11:67656273-67656295 CTAATTTAGCTGTTATTTAAAGG + Intergenic
1085006412 11:73094969-73094991 GAAATCCAGAAGATATTCAATGG - Intronic
1085876635 11:80415281-80415303 CTAATTCATAAGATTTTTAAAGG + Intergenic
1085898151 11:80664229-80664251 CTGATTCATAAAATATTTATGGG - Intergenic
1086353394 11:85966437-85966459 CTGACTAAGAAAATATTTAAAGG - Intronic
1086622357 11:88902511-88902533 TTCATTCAGAAAATATTTATTGG + Intronic
1086716122 11:90064368-90064390 TTATTTTAGAAGATAATTAACGG - Intergenic
1087049886 11:93875592-93875614 CTAATTCAAAGCTTATTTAAAGG - Intergenic
1087593758 11:100227182-100227204 CTATTTCAGTGGAAATTTAAGGG + Intronic
1087644737 11:100795460-100795482 CTAATTCAGCAAACATTTAGAGG + Intronic
1087800054 11:102493768-102493790 CTTATTCAACAGGTATTTAACGG + Exonic
1087870360 11:103286436-103286458 ATTATTCAGAAGCCATTTAAAGG + Intronic
1088183653 11:107139816-107139838 CTAATGCAAAATGTATTTAAAGG + Intergenic
1088210025 11:107444491-107444513 CCAAATAACAAGATATTTAAGGG - Intronic
1088793516 11:113247753-113247775 CATATTCAGATGATTTTTAAAGG - Intronic
1088966525 11:114727690-114727712 CTATTTCAGAAATTATTTACTGG + Intergenic
1089064842 11:115654730-115654752 TTTATTCAGAAAATATTTATTGG - Intergenic
1089754019 11:120673259-120673281 TTCATTCAGTAGATATTTAGTGG - Intronic
1089918751 11:122186408-122186430 CAAAATCAGAAGAAATTTTAAGG + Intergenic
1089940843 11:122415455-122415477 CTAGTTTAGAAGTAATTTAAAGG + Intergenic
1090135644 11:124196243-124196265 CTTATTCAGTAGATATAAAATGG - Intergenic
1090149018 11:124361772-124361794 CTAAATCAAAAGATATGTAGTGG - Intergenic
1091589874 12:1836670-1836692 CTGAGACAGAAGATTTTTAAAGG + Exonic
1091887707 12:4028717-4028739 CTTATTCAGCAAATATTTACTGG - Intergenic
1092591512 12:9956270-9956292 TTAACTCAGAAGTTATCTAAAGG - Intronic
1092993791 12:13928425-13928447 CTAATTCAGAAGATATTTAAAGG + Intronic
1093161405 12:15751553-15751575 CTTATTCAACAAATATTTAATGG + Intronic
1093231474 12:16549053-16549075 CTTATTCAGATGATCTTTTAAGG - Intronic
1093480817 12:19602072-19602094 CTGATTTAGATGATATTTAGAGG + Intronic
1093848724 12:24009575-24009597 CTATTTCAGCAGATTTTCAAGGG + Intergenic
1094427945 12:30335209-30335231 CTAAACCATATGATATTTAAAGG + Intergenic
1094433091 12:30391605-30391627 CTAATTCAGAAGTTGTCTAAAGG + Intergenic
1094468001 12:30774547-30774569 CTAATTCAAAGCTTATTTAAAGG + Intergenic
1094719002 12:33043141-33043163 TTAATTAAGGAGATATTTGAGGG - Intergenic
1095266477 12:40164462-40164484 CTAATTCAAATCTTATTTAAAGG - Intergenic
1095855712 12:46858777-46858799 CTAATTCAAAGCTTATTTAAAGG - Intergenic
1096821214 12:54236452-54236474 CTAATTCAGAACATGTTTTTGGG + Exonic
1096934134 12:55251770-55251792 TTACTTCAAAAGATTTTTAAAGG - Intergenic
1097252655 12:57645840-57645862 CTAATTCAAAGCTTATTTAAAGG + Intergenic
1097404438 12:59173176-59173198 CTAATTCAAAACATACTGAAGGG - Intergenic
1097598634 12:61664929-61664951 CTTATTTAGAGGCTATTTAAAGG - Intergenic
1097813379 12:64043894-64043916 TTAATTCAAAATATATTTATTGG + Intronic
1098666185 12:73166063-73166085 CTAATTCAAAGCTTATTTAAAGG + Intergenic
1098695235 12:73544561-73544583 CTAAGTCAATAGATATTAAATGG + Intergenic
1098716826 12:73839055-73839077 ATAAATCAGAAGAGATTAAAAGG - Intergenic
1098843657 12:75509134-75509156 ATGATTCAGAAGATAATTTACGG - Intronic
1099075187 12:78097902-78097924 CTAATGCCAAAGATATTTCAAGG + Intronic
1099365263 12:81759451-81759473 TTACTTCAGAATTTATTTAAGGG - Intronic
1099469772 12:83033453-83033475 CGAACTCAGAATATATTTTATGG - Intronic
1100972763 12:100089230-100089252 GTAATTCAGAAAATATTTTAGGG - Intronic
1101803152 12:108040169-108040191 CTCATTCAAAACATATTTATTGG + Intergenic
1101951008 12:109175062-109175084 CTAATTTAAAAAATATTCAAAGG + Intronic
1102907947 12:116691499-116691521 CTGATTCAGAAGGTATGGAATGG - Intergenic
1103013911 12:117479387-117479409 CTAAATTAGAACAAATTTAATGG - Intronic
1106425137 13:29621505-29621527 ATAATTCAGAAGATAAAAAATGG + Intergenic
1106435144 13:29716906-29716928 CTAATTCATACGTGATTTAAAGG - Intergenic
1106596718 13:31148373-31148395 ATGATTCAGAAGATACTGAAGGG - Exonic
1107138219 13:36968322-36968344 TTAATTCAGGTGAAATTTAAAGG + Intronic
1107692732 13:42968279-42968301 CTAATTTGGAAATTATTTAATGG - Intronic
1108383566 13:49877482-49877504 CTGGTTCAGAAGTTATCTAAAGG + Intergenic
1108885361 13:55174558-55174580 CTGATTTGGAAGATATTTGAGGG - Intergenic
1109454669 13:62568885-62568907 ATAATTGTGAAAATATTTAAGGG - Intergenic
1109584998 13:64388297-64388319 CAAATTAAGTAGATTTTTAAAGG + Intergenic
1109718866 13:66251864-66251886 CTGATTAAGAAGAGATTTCAGGG - Intergenic
1109977946 13:69866174-69866196 CAAATTGAGAAGTTGTTTAATGG + Intronic
1110403475 13:75121568-75121590 CTAATAGAAAAGATATTTGAGGG + Intergenic
1111431103 13:88149056-88149078 CTAATTCAGAAGTTATTAAAAGG - Intergenic
1111840470 13:93443560-93443582 CATATTCACAACATATTTAATGG + Intronic
1112413496 13:99184685-99184707 CTAATTCAAAGCTTATTTAAAGG - Intergenic
1112447604 13:99479200-99479222 CTAATTCAAAGCTTATTTAAAGG + Intergenic
1112534400 13:100236821-100236843 CTAATTGAGAAAATGTGTAAGGG + Intronic
1112583064 13:100693132-100693154 CTAATTCAGAAGTTACTAAAAGG - Intergenic
1112854190 13:103746213-103746235 ATAATTTAGAAGATATTGAATGG + Intergenic
1112991092 13:105514751-105514773 TTATTCCAGAAAATATTTAAAGG - Intergenic
1113898469 13:113782219-113782241 CTAATTCAAAGCTTATTTAAAGG - Intronic
1115099621 14:29683016-29683038 ATAATTCAGCAGATAGTGAACGG + Intronic
1115174910 14:30550943-30550965 CTAAGTGAGAGGACATTTAATGG - Intergenic
1115934144 14:38532494-38532516 TTATTTAAGAAGATATGTAAGGG - Intergenic
1116080065 14:40160881-40160903 CTAATACTGCAGAAATTTAAGGG + Intergenic
1116161057 14:41267082-41267104 CTAATTCAGAAGTTATTAAAAGG + Intergenic
1116263108 14:42656457-42656479 CTAATTCAAAACTTGTTTAAAGG + Intergenic
1116842414 14:49832763-49832785 GTAATTCAAAAAATATTTAATGG + Intronic
1117391089 14:55263632-55263654 TTAATTCAACAGATATTTATTGG + Intergenic
1117509479 14:56435095-56435117 CTAATTCAAAGGTTATTTAAAGG + Intergenic
1117862954 14:60112029-60112051 TTATTTCAGAAGATATGAAAGGG + Intronic
1119062315 14:71487559-71487581 CTCATTCATTACATATTTAATGG - Intronic
1119093294 14:71805005-71805027 CTAGTTCAAAAAATATGTAAAGG - Intergenic
1119750921 14:77076729-77076751 GTAATTAATAAGACATTTAAAGG - Intergenic
1120019009 14:79507088-79507110 CAAATTCTGAAGATATTTTCTGG + Intronic
1120563183 14:86021884-86021906 TTAATTCAGAAAATATTTATTGG - Intergenic
1120879740 14:89405795-89405817 CATATTCACAGGATATTTAAAGG + Intronic
1120915795 14:89709051-89709073 CTAATTCAACCGATTTTTAAAGG - Intergenic
1121147553 14:91598259-91598281 CTAATTCAAAGCTTATTTAAAGG - Intronic
1121781721 14:96626291-96626313 CTCATTCAGCAGATATTTATTGG + Intergenic
1121860148 14:97309568-97309590 CTAATGCACAAGCTCTTTAAAGG - Intergenic
1122186781 14:100004805-100004827 CTAATTCAAAGCTTATTTAAAGG - Intronic
1122187519 14:100012439-100012461 CTAATTAAGAAGGTATTTCCAGG - Intronic
1123201243 14:106666476-106666498 CTATTTTAAAAGATAATTAATGG - Intergenic
1123777541 15:23595368-23595390 ATAATTCAGAAGTTATCTAAAGG - Intronic
1124000670 15:25757510-25757532 CTAATTCAAAGGTTATTTAGAGG + Intronic
1124131610 15:26993028-26993050 CTGATACAGCAGAAATTTAAAGG - Intronic
1125187039 15:36942918-36942940 CTAAATTAGAAGCTATTGAAAGG - Intronic
1125565301 15:40673165-40673187 CTGATACAGAAGAAATTCAAAGG - Intergenic
1126193832 15:45908779-45908801 CTAATTCAGAAATTATTTAAAGG - Intergenic
1126893435 15:53232330-53232352 CAAATACAGAAAATATTTGAAGG + Intergenic
1127092188 15:55478343-55478365 CTTGTTCAGAAGAGATTTTATGG + Intronic
1127788524 15:62377672-62377694 CTCATTCAGCATATATTTATTGG - Intergenic
1128859849 15:71059195-71059217 CTAACTCAGAGGTTATTTATAGG + Intergenic
1130129050 15:81121421-81121443 CTAATTCAGAGGTTATTTGAAGG - Intronic
1131854337 15:96577278-96577300 TTCATTCAGAAAATATTTATTGG - Intergenic
1132006375 15:98231535-98231557 CTATTTCAGAGGATTTTTTATGG + Intergenic
1132335042 15:101042874-101042896 CTACTTCAGAAGATATATCCTGG - Intronic
1133726827 16:8545612-8545634 CTAATTCAGTAGATCATTAGTGG + Intergenic
1134003417 16:10800545-10800567 CTAACTCAGTGGTTATTTAATGG + Intronic
1135111888 16:19696761-19696783 CTAATTGAGAAGATATGGAATGG + Intronic
1135270323 16:21063840-21063862 CTAATTTAAAAGATAGTAAAGGG - Intronic
1135874174 16:26182154-26182176 CCAGTTCAGCAGATATTTATTGG + Intergenic
1135931447 16:26741042-26741064 CTAAATCAGATGACATTCAAAGG + Intergenic
1136100160 16:27988427-27988449 CTAGTTTAGAGGTTATTTAAAGG + Intronic
1138632413 16:58308874-58308896 CTAATTCAAAGGTCATTTAAAGG + Intronic
1138782486 16:59806036-59806058 CTCACTCAGAAGACATTCAAAGG + Intergenic
1139102752 16:63788114-63788136 CTAATTCAGAAGTTATTAAAAGG - Intergenic
1139996901 16:70989800-70989822 TTAATTCAGCTGATATTTACTGG + Intronic
1140228923 16:73101265-73101287 CTGATTCAGGAGATCTTGAATGG - Intergenic
1140301053 16:73757529-73757551 TTAATTCAGTAAATATTTATTGG + Intergenic
1140384359 16:74521453-74521475 CAAATTCAGGATATATTTCAAGG + Intronic
1140602004 16:76487853-76487875 CTGATTCTAAAGGTATTTAAAGG - Intronic
1141264153 16:82480611-82480633 CAAATACAGAAGAAATATAATGG - Intergenic
1143161433 17:4874335-4874357 CTCATTCAGAAGATATTTAGTGG + Intronic
1144713575 17:17419309-17419331 CTAAATAAGAAGGTATTTTAGGG + Intergenic
1146100408 17:29975227-29975249 GTATGTCAGAAGATATTAAAAGG - Intronic
1146266096 17:31453913-31453935 CTGAGTCAAAAGATATTCAATGG - Intronic
1146441707 17:32902197-32902219 CTAATTTAAAATGTATTTAAAGG - Intergenic
1147785347 17:42974470-42974492 TTCATTCAAAAGATATTTATTGG + Intronic
1148902146 17:50886385-50886407 ATAATGCAGAAGAAATTTCAAGG - Intergenic
1149318596 17:55462024-55462046 CTTGTTAAGAAGATAGTTAAAGG + Intergenic
1149476867 17:56969122-56969144 CTAATTCAAAACTTATTTAAAGG + Intergenic
1149903916 17:60507522-60507544 TTCATTTAGAAAATATTTAAGGG - Intronic
1150533202 17:66007744-66007766 ACAATTCAGAAGAAAGTTAAAGG + Intronic
1151118059 17:71761010-71761032 CTGATTCAGAAGCCATTTAAGGG + Intergenic
1152055106 17:78018488-78018510 CTTATTTAGAAAATATTTAATGG - Intronic
1153136552 18:1924081-1924103 CTAATTCAAAGCTTATTTAAGGG - Intergenic
1153356231 18:4138954-4138976 CCAATACAGCAGAAATTTAAAGG - Intronic
1154385446 18:13888048-13888070 CTAATTCTGATTACATTTAATGG - Intronic
1156136653 18:34048295-34048317 CTAGTTCAGTTGTTATTTAAAGG - Intronic
1156442282 18:37203399-37203421 GTAATTTATAAGTTATTTAAAGG - Intronic
1156867050 18:41900428-41900450 CTCATTCAGTAGATCTTTACTGG - Intergenic
1156988388 18:43376649-43376671 CTAATACAGTACATATTTAAGGG + Intergenic
1157008949 18:43623016-43623038 CAAGTTCACAACATATTTAATGG + Intergenic
1157099349 18:44715383-44715405 TTAATCCAGAAGTTATTTACAGG + Intronic
1157834778 18:50890608-50890630 CTAGTTTAGAGGTTATTTAAAGG - Intronic
1157912662 18:51632645-51632667 CTAATTCAAAGCTTATTTAAAGG + Intergenic
1158267131 18:55672051-55672073 TTACTTCAAAAAATATTTAAAGG - Intergenic
1158574315 18:58623334-58623356 CCAATACAGAAGATTTTTAATGG + Intronic
1159062052 18:63525200-63525222 CTAAATCAGAGGTGATTTAATGG - Intergenic
1159252282 18:65895361-65895383 GTTATTCAGCAGATGTTTAAAGG - Intergenic
1160126715 18:76180931-76180953 CTAATTTGGAGGTTATTTAAAGG - Intergenic
1160138944 18:76301910-76301932 CTCATTCAGAGGATATTGAATGG + Intergenic
1161833460 19:6627688-6627710 CAAATTCAGAAGTTATCTAAAGG - Intergenic
1162611183 19:11754793-11754815 CTGATTCAGATGATATTTAATGG - Intergenic
1165368568 19:35386670-35386692 CTAATTCAGAAGTTATCTAGAGG - Intergenic
1166643023 19:44510901-44510923 GGAATTGAGAAGATTTTTAAAGG + Intronic
1166937327 19:46342247-46342269 TAAAATCAGAAGATATTTGAAGG - Exonic
1202715386 1_KI270714v1_random:39521-39543 CTCATTCAGCAGATGTTTACTGG + Intergenic
925841757 2:7998625-7998647 CTGATTTAGAAAATATTTAAGGG - Intergenic
926635304 2:15172194-15172216 CTAATTTAGGAGATATGTAATGG + Intronic
927249302 2:20983426-20983448 TTAACTCAGAAAATATTTTAGGG + Intergenic
928594819 2:32849823-32849845 CTAATTCAGAAGGTGTTAGAGGG - Intergenic
928699014 2:33880085-33880107 AAAATTCAGAAGATTCTTAAAGG - Intergenic
928789179 2:34930801-34930823 CTAATTCAGAAGTTATTAAAAGG - Intergenic
928818625 2:35331672-35331694 CTAATTCAGAGGCTATTTAAAGG + Intergenic
928839348 2:35586451-35586473 CTAATTCAGAAGTTATTAAAGGG - Intergenic
928871084 2:35980587-35980609 CTATTTCTAAAGAAATTTAAAGG + Intergenic
928920973 2:36527032-36527054 TTATTTTAGAAGATATTTCAAGG + Intronic
929092063 2:38228613-38228635 CTAATTCATAAAATAATAAATGG - Intergenic
929408751 2:41672690-41672712 ATAATTCAGAAGTTATTTAGAGG + Intergenic
929673590 2:43901389-43901411 GTAGTTCAGAAGATGTTAAATGG - Exonic
930704444 2:54490401-54490423 TAAATTCAGAAAGTATTTAAGGG + Intronic
930841316 2:55849376-55849398 CTAATTCAGAGGTTATTTAAAGG - Intergenic
930984915 2:57573707-57573729 ATATTTGAGAAAATATTTAAAGG - Intergenic
931088366 2:58859816-58859838 CTAATTCAGAAGTTAATGGAAGG - Intergenic
931680477 2:64743361-64743383 TTAATTCAACAGATATTTATTGG - Intronic
932470833 2:71955077-71955099 CTGATTCTGAAGATATGGAAAGG - Intergenic
932499531 2:72171381-72171403 CCAACTCAGAAAATATTTACTGG - Intergenic
933067528 2:77816528-77816550 CTTGTCAAGAAGATATTTAAGGG + Intergenic
933359619 2:81264192-81264214 TTACTTCAAAAGATATTGAATGG + Intergenic
933435739 2:82247413-82247435 TTGATTCAGCAAATATTTAAGGG + Intergenic
933545183 2:83701232-83701254 GTCATTCATAAGCTATTTAATGG - Intergenic
933822820 2:86129964-86129986 CTCATTCTGATTATATTTAAAGG + Intronic
935186140 2:100734775-100734797 TTCATTTAGAAGATATTTACCGG - Intergenic
935957721 2:108394796-108394818 CTAATTCAAAGCTTATTTAAAGG - Intergenic
935962579 2:108441763-108441785 CTAATTCGAAAGTTATCTAAAGG - Intergenic
936482415 2:112896946-112896968 TTTATTCAGAAGAAATTTCATGG + Intergenic
936699416 2:114992683-114992705 CTGAATCACAAGACATTTAAAGG + Intronic
936926548 2:117742826-117742848 TTAATTGAGAAAATATTTTAAGG + Intergenic
938176063 2:129130414-129130436 CTAATTCAGAAGTTATCTGAAGG + Intergenic
938278412 2:130048425-130048447 CTAATCCTGAAGACATTGAATGG - Intergenic
938329388 2:130439284-130439306 CTAATCCTGAAGACATTGAATGG - Intergenic
938360560 2:130682219-130682241 CTAATCCTGAAGACATTGAATGG + Intergenic
938436963 2:131288927-131288949 CTAATCCTGAAGACATTGAATGG + Intronic
938960927 2:136340990-136341012 TTCAGTCAGCAGATATTTAATGG - Intergenic
939198772 2:139007437-139007459 CTAATTTAAAAAATATTTAAAGG + Intergenic
939339346 2:140873846-140873868 CTAATTCAAAGCTTATTTAAAGG + Intronic
939604265 2:144234400-144234422 CTAATGCACAAGATAAGTAAAGG + Intronic
939608475 2:144281312-144281334 CTAATTCTGATGATATATAATGG - Intronic
939779802 2:146431803-146431825 CTACTACAGAAGATACTTATTGG - Intergenic
940128800 2:150358244-150358266 CAAATTCAGAGGATTTTTCATGG + Intergenic
940306838 2:152235981-152236003 ATAATTCCAAAGATATTCAAAGG - Intergenic
940988094 2:160069324-160069346 CTAATTCAAAGCTTATTTAAAGG - Intergenic
941399144 2:165009017-165009039 CTAAGTTGGAAGGTATTTAATGG - Intergenic
941433325 2:165437195-165437217 CTAGTTGAGAAGCTATTTAAAGG - Intergenic
941637752 2:167953974-167953996 GTAATGCAGATGATATCTAAAGG + Intergenic
942225674 2:173813289-173813311 AAAAATCAGAAGATATTTAGTGG - Intergenic
942520954 2:176803430-176803452 CTAATTCATAATATGTTTTATGG + Intergenic
943328756 2:186533674-186533696 CTATTTTAGAAGATATTTAAAGG + Intergenic
943551277 2:189343234-189343256 CTAATTCAGAATTTATCTAAAGG - Intergenic
943666333 2:190612831-190612853 CTAATTCAAAGCTTATTTAAAGG - Intergenic
943739247 2:191393124-191393146 CTCATTCAGAAGATATATCGGGG + Exonic
943780167 2:191814714-191814736 CTAGCTCAGAAGAGATCTAATGG - Intergenic
944537178 2:200722697-200722719 TTATTTCAGAACAAATTTAAGGG + Intergenic
944914176 2:204340943-204340965 TTAAATTAGAAGATATATAATGG + Intergenic
945617485 2:212090716-212090738 CCACTTCAGATGCTATTTAAAGG + Intronic
945637665 2:212376640-212376662 CTAATTTAAAATATCTTTAAAGG + Intronic
945779710 2:214154137-214154159 CTATTTCAGAAAATGTTAAATGG + Intronic
946813622 2:223553154-223553176 CTCATTCAGCACATATTTATTGG + Intergenic
947056090 2:226105663-226105685 GTAATTCAGAACAAATTTCATGG - Intergenic
947156623 2:227168774-227168796 ATAATTCAGAAAATAATTACAGG - Intronic
947483482 2:230524937-230524959 CTAATTCAGAGGTTATCTGAAGG + Intronic
948641936 2:239380541-239380563 CTAATTGAATAGCTATTTAATGG + Intronic
949061698 2:241963155-241963177 CTAATTTGGAGGTTATTTAAAGG + Intergenic
1168825070 20:805676-805698 CTAATTCAAAGCTTATTTAAAGG + Intergenic
1169314472 20:4577115-4577137 CTAATGCAGAAGGTATTTCAAGG - Intergenic
1170843490 20:19942950-19942972 CTAACTAAGCAGATATTTTATGG - Intronic
1170964529 20:21054345-21054367 TTAATTGAGAAAACATTTAAAGG + Intergenic
1171288438 20:23964424-23964446 CTAATTCAACAGTTATCTAAAGG - Intergenic
1171943994 20:31359735-31359757 CTGATTCAGTAGATCTGTAATGG - Intergenic
1173444872 20:43108604-43108626 CTGATTCAGAAGACCTTTGAGGG - Intronic
1173651596 20:44669492-44669514 CTAGTTTAGAGGTTATTTAAAGG + Intergenic
1174414095 20:50355858-50355880 TTAATTCAGCAGATATTTTATGG + Intergenic
1177550046 21:22608867-22608889 CTAATTCAAAACTTACTTAAAGG - Intergenic
1177611398 21:23453369-23453391 CTAATTCAGAGGTTATTTAAGGG - Intergenic
1177994336 21:28077047-28077069 CTAATTCCTTAAATATTTAATGG - Intergenic
1178185206 21:30210710-30210732 CTAATTCACAGAATTTTTAAAGG + Intergenic
1180582307 22:16850527-16850549 CTAATTCAGAGGTTATTTAAAGG + Intergenic
1182390280 22:29988381-29988403 CTAATTAAAAAGATCTATAAGGG - Intronic
1182397807 22:30049027-30049049 CTAAGGAAGAATATATTTAATGG - Intergenic
1182565453 22:31195250-31195272 CCAATTATGATGATATTTAAAGG + Intronic
1182972724 22:34592994-34593016 CTAATTCAATAGATATTTATTGG + Intergenic
1182990165 22:34759960-34759982 CTAATTGTTAAGGTATTTAATGG + Intergenic
1184312777 22:43658823-43658845 CTAATTCTGTGGATATTTTAAGG - Intronic
1184576711 22:45373996-45374018 CTAATTCAAAGCTTATTTAAAGG + Intronic
1203244490 22_KI270733v1_random:51984-52006 TTAATTCTGAAGATATAGAAGGG - Intergenic
949669330 3:6380429-6380451 CTGACTCAAAAGATATATAAGGG + Intergenic
949823215 3:8137756-8137778 CTCATTCAGTAGATATTTATGGG - Intergenic
949963325 3:9333313-9333335 ATAATTCAGATGATATCTTAGGG + Intronic
950232578 3:11289565-11289587 ATAAGTCAGAAAATATTTGAAGG + Intronic
951300707 3:20992776-20992798 CTAATTCAAAGCTTATTTAAGGG - Intergenic
953150144 3:40317192-40317214 CTATTACAGAAGAAATTGAAGGG + Intergenic
953308900 3:41857779-41857801 CTAATACTGCAGAAATTTAAAGG - Intronic
953525824 3:43689509-43689531 CTAATTCATAAAATATTTTAGGG - Intronic
953606925 3:44418397-44418419 GTAATTTAAAAGATGTTTAATGG - Intergenic
954166512 3:48763313-48763335 TTAATTAAGATGATATTAAAAGG - Intronic
954587515 3:51748750-51748772 CTAATTCAAAGCTTATTTAAAGG - Intergenic
955416076 3:58692426-58692448 CTAATTCAAACCTTATTTAAAGG - Intergenic
955500014 3:59574229-59574251 GGAAGTCAGAAGATATTCAATGG - Intergenic
955612601 3:60773885-60773907 CTAATCAAGAAGATGATTAAAGG - Intronic
956043938 3:65175194-65175216 TTATTCCAGAAAATATTTAATGG - Intergenic
956342495 3:68241619-68241641 CCAATTCAGAGGAAATTAAAAGG - Intronic
956564731 3:70623732-70623754 ATTATTCAGAAGATATTTAGAGG + Intergenic
956895596 3:73656516-73656538 CTTACTCAGAAGAAATTTATTGG - Intergenic
957901185 3:86493800-86493822 CTAATTCAGCACGTATTAAAAGG - Intergenic
957995330 3:87681486-87681508 CTGATTCAGAGGTTATTTACAGG - Intergenic
958493763 3:94814810-94814832 ATAATTCAGAAGAAATCTAGGGG + Intergenic
958497731 3:94865731-94865753 CTAATTCAGAAGAAATATAATGG - Intergenic
958509503 3:95028379-95028401 TTAATTTAGAATATATTTACTGG - Intergenic
958522979 3:95215212-95215234 CTAATTCAAAGCTTATTTAAAGG + Intergenic
959467052 3:106701143-106701165 CCAAGTCAGAACATATGTAAAGG - Intergenic
959478043 3:106835995-106836017 CGAATTCAGAAGTTACCTAAAGG - Intergenic
959606471 3:108246481-108246503 CTTATTTGGAAGTTATTTAAAGG + Intergenic
959816544 3:110680591-110680613 CTAAGTGAGAAAATATTTGAAGG + Intergenic
959826860 3:110807615-110807637 CTAATACAGAAGAGATTAATAGG + Intergenic
959980642 3:112512733-112512755 CTAATTCAAAGCTTATTTAAAGG - Intergenic
960031215 3:113056705-113056727 GGAATTGACAAGATATTTAAAGG + Intergenic
960182897 3:114603381-114603403 TTAATCCAGAAGATATTTTAAGG - Intronic
960457700 3:117893386-117893408 ATTATTTAGAAGCTATTTAAAGG + Intergenic
960589065 3:119347829-119347851 CTAATTCTGAAGCTCTTAAAGGG + Intronic
960774102 3:121229321-121229343 CTAATTCAAAGGTTATCTAAAGG - Intronic
961322685 3:126087516-126087538 CTAATTCAAAGCTTATTTAAAGG + Intronic
963577935 3:147085173-147085195 CTACTTTAGAAGAATTTTAATGG + Intergenic
963910449 3:150812933-150812955 AAAATACAGAAGATATTTATTGG + Intergenic
964045973 3:152327250-152327272 TTTACTCAGAAGATATTTATTGG + Intronic
964148338 3:153493478-153493500 CTAATAGAGTAGATATATAAAGG + Intronic
964308503 3:155366287-155366309 CTAGTTTAGAGGTTATTTAAAGG + Intergenic
964511772 3:157460419-157460441 CTCATTCAAAAAATATTTATTGG + Intronic
964915743 3:161839026-161839048 CTAATATAGAAGATATTTAGAGG + Intergenic
965257215 3:166428795-166428817 TCCATTCAGAAGATATTGAATGG + Intergenic
965351118 3:167612650-167612672 GAAATTCAGAAGATTGTTAATGG + Intronic
966139963 3:176745732-176745754 TCAAGTCAGAAGATATTGAAAGG + Intergenic
966266454 3:178050804-178050826 CTAATTCAGAGGTTATTTGAAGG + Intergenic
966348407 3:179003849-179003871 CTAGTTTAGAGGTTATTTAAAGG + Intergenic
967244628 3:187473418-187473440 CTAATTCAAAGCTTATTTAAAGG + Intergenic
968294453 3:197563738-197563760 CTAATTCAAAGCTTATTTAAAGG + Intronic
968421954 4:492883-492905 CTAATTCAAAGCTTATTTAAAGG - Intronic
969187596 4:5488853-5488875 CTAATTCAGAGGCTATTTAGAGG - Intronic
969598643 4:8162940-8162962 CTAATTTTGAAGCAATTTAAAGG - Intergenic
969987237 4:11225050-11225072 TTCATTCAGCAAATATTTAACGG - Intergenic
971097401 4:23423453-23423475 CTAATTTGGAAGATATTCACAGG + Intergenic
971529251 4:27663709-27663731 CTAGTTCTGAAGGTATTTCATGG + Intergenic
971992247 4:33914295-33914317 CTAATTCTGAAGTTATTAAAGGG + Intergenic
972207006 4:36785848-36785870 TTCATTCAGAAAATATTTAATGG + Intergenic
972238706 4:37164854-37164876 TGAATTCCGAAGATATTAAAGGG - Intergenic
972625158 4:40789957-40789979 CTAAGTCACAAGATCCTTAAAGG + Intronic
972952576 4:44346295-44346317 CTCATTCAAAAGATATTTATTGG + Intronic
973148868 4:46863115-46863137 CTAATTCAAAAGCTATGTAAAGG + Intronic
973260087 4:48154604-48154626 CTAGTTTAGAGGTTATTTAAAGG + Intronic
974168692 4:58238222-58238244 CTGTTTGAGAAGATTTTTAAAGG + Intergenic
974273965 4:59690732-59690754 CACATTCAGAAGATATTTGGTGG + Intergenic
974481010 4:62442873-62442895 CTAATTAAGAATATTTTTCAAGG + Intergenic
974816253 4:67007714-67007736 CAAATTCAGTACATATTTAATGG + Intergenic
974948333 4:68555831-68555853 CTAATTCAAAGCTTATTTAAAGG + Intronic
975065884 4:70063298-70063320 CTAATTCAAAGGTTATTTAGAGG - Intergenic
975224996 4:71861055-71861077 CTAACTCAAAAGTTATTTAGAGG - Intergenic
976486600 4:85612640-85612662 CCATTTTAGAAGATATTTAGAGG + Intronic
976844074 4:89467123-89467145 CTATTTCAGAATATAAATAAAGG + Intergenic
977042683 4:92034436-92034458 CTAATTGAAAACTTATTTAAAGG - Intergenic
977622282 4:99150828-99150850 CAAATTCAGAAGTTATCTAAAGG + Intronic
977720419 4:100233668-100233690 CTAATTCAAAGCTTATTTAAAGG - Intergenic
977761966 4:100748726-100748748 CTAATTCAAAGCTTATTTAAAGG + Intronic
978032293 4:103949845-103949867 CTAATTCAAAGCTTATTTAAAGG + Intergenic
978357130 4:107888680-107888702 CTAATTCAAAGCTTATTTAAAGG - Intronic
979005433 4:115289200-115289222 CTAAATCTGCAGATTTTTAAAGG - Intergenic
979094091 4:116521892-116521914 ATAATTCAAAAAATAATTAATGG + Intergenic
979153003 4:117343858-117343880 CCAATTTAAGAGATATTTAAAGG - Intergenic
979169190 4:117578217-117578239 TTAATTCAGAAGAAACGTAAAGG + Intergenic
979695422 4:123607818-123607840 CTAATTAACAAGATATTTTCTGG + Intergenic
979731881 4:124033340-124033362 CTAATTGTGAGGTTATTTAAAGG + Intergenic
980269950 4:130571425-130571447 CTAATTCAAAACACATTTAAAGG - Intergenic
980410917 4:132417676-132417698 CTAATTCAGAAGTTATCAAAAGG - Intergenic
980463023 4:133142226-133142248 GTAATTCAGAAGATACATAATGG - Intergenic
980476443 4:133323840-133323862 ATAAATGAGGAGATATTTAATGG - Intergenic
980690419 4:136289625-136289647 CTACTTAAGAATATATTCAATGG + Intergenic
981147052 4:141336484-141336506 CTAATTCAGAAGTTATCTAAAGG + Intergenic
981292600 4:143093499-143093521 CTAATTCAAAGCTTATTTAAAGG + Intergenic
981545062 4:145885235-145885257 TTAATTTATAAGATTTTTAAAGG - Intronic
981579296 4:146236169-146236191 CTGAGTCAGAAGACCTTTAAAGG - Intergenic
981602179 4:146502413-146502435 CTACATCAGAAGCTATTTATAGG + Intronic
981771489 4:148314719-148314741 ATAATCCAGAAGATTTTAAAAGG + Intronic
982417567 4:155154590-155154612 CTAATTTGGAGGTTATTTAAAGG + Intergenic
982737868 4:159024973-159024995 CTACTTCATAGGGTATTTAATGG - Intronic
982887700 4:160802922-160802944 CTGATTGAGAAGAGATTTCAAGG + Intergenic
983012119 4:162560526-162560548 CTAATTCAAAGATTATTTAAAGG - Intergenic
983253527 4:165372886-165372908 ATAAATTAGAAGATATTTCAAGG - Intronic
983285282 4:165731494-165731516 CTACTACAGAAGATGTTGAATGG - Intergenic
984085835 4:175310259-175310281 CTAATTCAGCTGATATTTATAGG - Intergenic
984119538 4:175724991-175725013 TTAGTTCAGGAGATATGTAAGGG - Intronic
984197140 4:176671882-176671904 AGAAATCAGAAGATATTTCAGGG - Intergenic
984304206 4:177966157-177966179 TTAATGCAGAAGTCATTTAAAGG - Intronic
984589243 4:181598504-181598526 TTAATTAAGAATATTTTTAAAGG + Intergenic
986088747 5:4480673-4480695 CTAAGGCAGAAAATATTTCATGG + Intergenic
986559618 5:9047449-9047471 GAAAATCAGAAGAAATTTAATGG - Intronic
986559623 5:9047491-9047513 CACATTCAGAACAAATTTAATGG - Intronic
987037531 5:14033112-14033134 CTAATAATAAAGATATTTAAGGG - Intergenic
987719987 5:21620921-21620943 CTAATTCAAAGCTTATTTAAGGG + Intergenic
987817593 5:22922877-22922899 CTAATTCAGAGTAAATTCAATGG - Intergenic
987909126 5:24118903-24118925 TTAAATTAGCAGATATTTAATGG + Intronic
988030363 5:25756087-25756109 CTAATTCAGAAGTTCTCTAAAGG - Intergenic
988134572 5:27154007-27154029 CTAACTCAGAGGTTATTAAAAGG + Intergenic
988176823 5:27737694-27737716 CTATTTCAGAAGATTGTTATAGG - Intergenic
988268991 5:28990407-28990429 CCAAGTTATAAGATATTTAAGGG + Intergenic
989477108 5:41886819-41886841 CTAATTCAAAAACTATTTAAAGG - Intergenic
990025606 5:51183803-51183825 TTTATTCAGAAAATATTTATTGG + Intergenic
990148849 5:52793299-52793321 CAAACTCAGAAAATACTTAAGGG + Intronic
990186028 5:53210548-53210570 CTAATTCAAAGCTTATTTAAGGG - Intergenic
990398512 5:55410540-55410562 CTAACTGAGATGATGTTTAATGG + Exonic
990664640 5:58058480-58058502 CTAATTCAGCACATATTAAAAGG - Intergenic
990753960 5:59047463-59047485 CTCACTTAGAAGATTTTTAATGG - Intronic
991106977 5:62854609-62854631 CTAATACAGAGGATGTTTGAAGG + Intergenic
991423851 5:66470129-66470151 CTAATTCAAAGCTTATTTAAGGG - Intergenic
991524318 5:67539587-67539609 CACATGCAGAAGATATTTAAGGG + Intergenic
991530649 5:67610195-67610217 CTAATTCAGCAGAAATTTCATGG + Intergenic
991586394 5:68206453-68206475 TTAATTCAGAAAGTATTTATTGG + Intergenic
991740755 5:69671757-69671779 TTAATCCAGATCATATTTAATGG - Intergenic
991756864 5:69882693-69882715 TTAATCCAGATCATATTTAATGG + Intergenic
991792329 5:70251498-70251520 TTAATCCAGATCATATTTAATGG - Intergenic
991836267 5:70758575-70758597 TTAATCCAGATCATATTTAATGG + Intergenic
991884777 5:71251823-71251845 TTAATCCAGATCATATTTAATGG - Intergenic
992176908 5:74158228-74158250 CCAATTCAGAAGATTATTTAGGG - Intergenic
992292682 5:75295615-75295637 CTAATTCAAAGCTTATTTAAAGG + Intergenic
992293461 5:75304252-75304274 CTAATTCAAAGGTTATTTAAAGG + Intergenic
992539931 5:77754330-77754352 CTAATTCAAAGCTTATTTAAAGG - Intronic
992669109 5:79041104-79041126 CAATTTCATAAGATATTGAAGGG - Intronic
992676682 5:79112282-79112304 CAGATTCAGAAGATATTGGAAGG - Intronic
992734282 5:79703327-79703349 CAGATTCAGCTGATATTTAATGG - Intronic
993427955 5:87793943-87793965 CTAATGCTGAATATTTTTAATGG + Intergenic
993507911 5:88733578-88733600 ATATTTCAGGAGATATTTATGGG + Intronic
994008850 5:94876256-94876278 ATAATTAAGGAGATAATTAATGG - Intronic
994225920 5:97251347-97251369 TTAATTAAAAAGAAATTTAAAGG - Intergenic
994694195 5:103053905-103053927 CTAGTTTAGAGGTTATTTAAAGG - Intergenic
995608671 5:113886517-113886539 TTAATTCAGTAGACATTTATTGG + Intergenic
995869735 5:116732105-116732127 CTAATTCAGAATCATTTTAATGG - Intergenic
995923870 5:117345227-117345249 CTAATTGAGAAGATACTAACAGG + Intergenic
996486038 5:124035744-124035766 CTAATCCAACAAATATTTAATGG + Intergenic
999358541 5:150960745-150960767 CTAATTCAAAGTTTATTTAAAGG + Intergenic
999687484 5:154115990-154116012 CTCATTCAGTAAATATTTATGGG - Intronic
1000472757 5:161666264-161666286 TTAATTAAAAATATATTTAATGG - Intronic
1000568238 5:162878910-162878932 CTATTTCAGAAGTTATCTAAAGG - Intergenic
1000722481 5:164725553-164725575 CTAATTTAAAAAATATATAATGG - Intergenic
1000767660 5:165311633-165311655 GAAATTCAGAAGATTTTTCAGGG + Intergenic
1001222992 5:169918923-169918945 CTAATTTAAAAGATATTTTAGGG + Intronic
1001862909 5:175074622-175074644 CTAATACAGATGTTATTTAAAGG + Intergenic
1002030867 5:176429062-176429084 CTAATTCAAAGCTTATTTAAAGG - Intergenic
1002890388 6:1326788-1326810 CTAAGTCAGAAGGAATCTAAAGG + Intergenic
1002946696 6:1768127-1768149 CTGATTTAAAAGATATTTAAAGG - Intronic
1003417165 6:5920466-5920488 GAAATTAAGAAGTTATTTAATGG + Intergenic
1003896499 6:10612873-10612895 CTTATTTTGAAGATATTAAAGGG + Intronic
1004646414 6:17565887-17565909 CTAATTCAAAGCTTATTTAAAGG - Intergenic
1005370958 6:25132490-25132512 CTAATTCAAAGCTTATTTAAAGG + Intergenic
1005567559 6:27112271-27112293 CAAATTCAGAAACTATATAAAGG - Intergenic
1007075106 6:39061221-39061243 CAAAGACAGAAGATATTCAAAGG + Intronic
1008002186 6:46372074-46372096 CTAATTCAAAATTAATTTAAAGG + Intronic
1008229248 6:48963985-48964007 GTAATTCAGGAGAAAATTAAGGG + Intergenic
1008649899 6:53551457-53551479 CTGATCCAGAAGAGAATTAACGG + Intronic
1008720532 6:54344615-54344637 GTATTTCTGAAGATATCTAAAGG + Intronic
1008752992 6:54758805-54758827 ACAATTCAGAAAATATGTAAGGG - Intergenic
1009405020 6:63301406-63301428 CTAGTTTAGAGGTTATTTAAAGG + Intronic
1009609985 6:65929538-65929560 CTAAATCCAAAGAAATTTAATGG + Intergenic
1009993743 6:70876708-70876730 CTCATTCAGAAGCTCTTTAGGGG + Intronic
1010182950 6:73108907-73108929 TTAATCCAGAAGATAATGAAGGG + Intronic
1010203684 6:73304616-73304638 CAAATTCAGAAGATATAAAAGGG - Intronic
1010405514 6:75501272-75501294 ATAATTAAGAAGATAATTGAGGG + Intergenic
1011122890 6:83973938-83973960 CTACTTCAAAGGTTATTTAAAGG - Intergenic
1011144172 6:84194024-84194046 CAAATTAAGAAGTCATTTAAAGG - Intronic
1011939828 6:92829226-92829248 CTGATTCAAAATTTATTTAAAGG + Intergenic
1011991291 6:93521260-93521282 CTAATTGAGAAGAAAGATAAAGG + Intergenic
1012043832 6:94243625-94243647 CTAATGTAGAAGATAAATAAAGG - Intergenic
1012218866 6:96623567-96623589 TTAATTCAGAAAGTATTTATTGG - Intergenic
1012842971 6:104353430-104353452 TTAATCCAGAAGTTATTTCAAGG - Intergenic
1012866899 6:104629044-104629066 TTAATTTAGAAGATATAAAATGG + Intergenic
1013569396 6:111406553-111406575 CTGATTCAGGAGACATATAAGGG + Intronic
1013922885 6:115430580-115430602 CTGACTCAGAAGATAATGAATGG + Intergenic
1014592434 6:123290775-123290797 CTAATTTGGAAGTTATTAAAAGG + Intronic
1015121092 6:129702433-129702455 TTTATTCAGTTGATATTTAATGG - Intronic
1015368907 6:132428435-132428457 CTAATTCCACAGATATTTACTGG - Intergenic
1015550577 6:134408390-134408412 AAAATTCAGAAGATATAAAATGG + Intergenic
1016200786 6:141405169-141405191 CTAATTCAGCAGTTATCTAAAGG + Intergenic
1016506650 6:144788861-144788883 CCAATTCATAATATTTTTAAAGG + Intronic
1017351386 6:153446332-153446354 CTAATTCAAAGCTTATTTAAAGG - Intergenic
1018145713 6:160886072-160886094 CTAATTCAAAGCTTATTTAAAGG + Intergenic
1018889469 6:167973184-167973206 TTAATTCAGCAGATGTTTATGGG + Intergenic
1020434259 7:8145589-8145611 CTGATTTAGAAAATATTTTACGG - Intronic
1021003690 7:15366627-15366649 CTAATATAGAAAATATTTAAAGG + Intronic
1022284148 7:28939036-28939058 CTGATTCAGAAAATATTTTTAGG + Intergenic
1022418260 7:30196848-30196870 CTAATTCAAAGGTTATTTAAAGG - Intergenic
1022883662 7:34619370-34619392 CTAATATAGAATATATTTAAGGG - Intergenic
1023466359 7:40459910-40459932 CAGATTCAGAAGACATGTAAAGG - Intronic
1023668046 7:42545538-42545560 GCAATTCAGAAGTTATTGAAAGG - Intergenic
1024906730 7:54391210-54391232 CTAATTCAAAACTTATTTAAAGG - Intergenic
1025256386 7:57386353-57386375 TTAATTCAGCAGATATTTTATGG - Intergenic
1025536874 7:61959218-61959240 CTAATTGAGGAAATATTCAATGG + Intergenic
1025764185 7:64427326-64427348 ATAATTCAGAAGATAAGAAAAGG - Intergenic
1025797231 7:64750228-64750250 CTAATTCAAAGCTTATTTAAAGG - Intergenic
1027708781 7:81570655-81570677 ATATTTCAGAAAATATTTCATGG + Intergenic
1027789918 7:82626908-82626930 CTGATTCAGATGTTATTTCACGG + Intergenic
1028160647 7:87480802-87480824 CTAATTGAGAAGAGATTTTTAGG - Intergenic
1028380118 7:90191006-90191028 GTAATTCAGAGGTTATCTAAAGG - Intronic
1028385524 7:90249044-90249066 TAAATTCAGATGATATTTACAGG + Intronic
1028591815 7:92504904-92504926 TTAATACAGAAGATATGAAATGG + Intronic
1028605805 7:92654465-92654487 CTTATTCTGTAAATATTTAATGG + Intronic
1030370169 7:108690589-108690611 GAAATTCAGAAGATTATTAATGG - Intergenic
1030599755 7:111580343-111580365 CTAATTCATTAGATAATTTAAGG - Intergenic
1030647993 7:112085667-112085689 CTAATTCCTAAGATAAATAATGG + Intronic
1030713249 7:112778794-112778816 CTAAATAAGTAGATATTTAGGGG + Intronic
1030771666 7:113483315-113483337 ATAATAGAGAAAATATTTAAAGG + Intergenic
1031160308 7:118159168-118159190 CTAATTCAAAAGTTATTTAAAGG - Intergenic
1031162724 7:118187931-118187953 CTAAGACAAAGGATATTTAAGGG - Intronic
1031169626 7:118276408-118276430 CTAATTCAGAGAATAAATAAGGG - Intergenic
1034130649 7:148713598-148713620 CTAATTCCTAAGATGTTTATAGG + Intronic
1034206950 7:149325170-149325192 CTAATTCAGAGATTATTTAAAGG + Intergenic
1035434149 7:158845936-158845958 CTACTTCAAAGGTTATTTAAAGG + Intergenic
1035663006 8:1361342-1361364 CTACTTCAGATGCTATTTATAGG + Intergenic
1036099216 8:5758831-5758853 CTTGTTCATAAGATATTTTAAGG - Intergenic
1037423415 8:18728019-18728041 TTCATTCAGCAAATATTTAAGGG - Intronic
1037972699 8:23185335-23185357 CTAATTCAGAAGTTATCTAAAGG - Intergenic
1039924662 8:41918461-41918483 CTACTTTTGAAGATATTGAAAGG - Intergenic
1040759347 8:50820023-50820045 CTAATACAGAAGAAATTCTAAGG - Intergenic
1041425247 8:57713524-57713546 CTAATTCAGCAAATATTTTGAGG + Intergenic
1041510500 8:58649860-58649882 CTAATTCAAGAGAGGTTTAATGG - Intronic
1041651049 8:60303416-60303438 CTAATTCAAAGCTTATTTAAAGG - Intergenic
1041819788 8:62017979-62018001 CTAATTCAGAAAACATTTAATGG + Intergenic
1041823462 8:62065049-62065071 CAGATTTAGAAGACATTTAAAGG + Intergenic
1041871387 8:62638480-62638502 ATAATACAGAAGATTTTGAATGG - Intronic
1042699166 8:71593476-71593498 GTAATACAGAATACATTTAAAGG + Intergenic
1044367526 8:91366903-91366925 TTTATTCAGTATATATTTAATGG + Intronic
1045643404 8:104277031-104277053 TAAATTCAGAAGTTATCTAAAGG - Intergenic
1046314615 8:112483037-112483059 CTAATACAGCATATATTTATTGG - Intronic
1046814536 8:118569859-118569881 CTAATACAGCATATATCTAAGGG + Intronic
1047323943 8:123818509-123818531 TTAATTCATAATATATTTAGGGG - Intergenic
1047331285 8:123889684-123889706 CTAATTCAGAAGTTATCTAAAGG + Intronic
1047380966 8:124362268-124362290 CTAGTTTAGAAGATATTTGAAGG + Intronic
1047670971 8:127146899-127146921 CTAATTCATAAGTTATGTAAAGG - Intergenic
1047933922 8:129757226-129757248 CTGATACAGCAGAAATTTAAAGG + Intronic
1049456358 8:142692938-142692960 CTAATTCAGAAGTTATCTAAAGG - Intergenic
1049481410 8:142825548-142825570 CTAATTCAGAAGTTATCTAAAGG + Intergenic
1049950921 9:643281-643303 GTAATCAAAAAGATATTTAAAGG - Intronic
1049996429 9:1039153-1039175 CTAATTCTTAAGTTATTTGAGGG - Intergenic
1050185712 9:2970780-2970802 CAAATTCTGATGATTTTTAATGG - Intergenic
1050210568 9:3251149-3251171 ATGTTTCTGAAGATATTTAATGG + Intronic
1050553411 9:6768009-6768031 AAAATTCAGAAGGTATTAAAGGG + Intronic
1050872120 9:10585066-10585088 CTATTTCACAATTTATTTAAGGG - Intronic
1050889982 9:10812258-10812280 TAAATTCTGAAGATATTTACAGG - Intergenic
1050987676 9:12103581-12103603 ATAATTTGCAAGATATTTAAAGG - Intergenic
1051904386 9:22078738-22078760 CTAATGAAGAAGATTTTGAAGGG - Intergenic
1052278406 9:26704789-26704811 GTAATACAGAAGCTATTTATAGG - Intergenic
1052616497 9:30848855-30848877 TTAACTCAAATGATATTTAAAGG - Intergenic
1052770356 9:32682985-32683007 CTAATACAGCAGAAATTCAAAGG + Intergenic
1053075492 9:35130174-35130196 CTAATTCAAAGCTTATTTAAAGG + Intergenic
1053251289 9:36576066-36576088 CTAATTCAGAAATATTTTAAAGG - Intronic
1053917092 9:42951527-42951549 GCAATTCTGAAGACATTTAATGG + Intergenic
1054758639 9:68984498-68984520 ATTATTCAGAATACATTTAATGG + Intronic
1055166279 9:73199284-73199306 TTAATTCAGAATATATTTTTTGG - Intergenic
1056104211 9:83330849-83330871 CTAGTTCACATGATATTAAAAGG + Intronic
1056289643 9:85129722-85129744 CTAATTCAGAAGGTCTAGAATGG - Intergenic
1056996276 9:91463007-91463029 CTAATTCTATAGATATTAAAAGG - Intergenic
1057779182 9:98035877-98035899 CTCATTCAGAAAATATTTATTGG + Intergenic
1057995052 9:99814545-99814567 CTAATTCAGAACAGATGTCAGGG + Intergenic
1058384055 9:104412199-104412221 CTAATTCAAAACTTATGTAAAGG + Intergenic
1059478347 9:114567817-114567839 CTAATTCAGACATTATTTAAAGG - Intergenic
1059825584 9:118024751-118024773 TTTATTCAGGAGATATTTAAAGG + Intergenic
1059870465 9:118568274-118568296 CTAATTCAGATGAGAGATAATGG - Intergenic
1062259335 9:135652449-135652471 CTAATTCAAAGGCTATTTAAAGG + Intergenic
1186025095 X:5301502-5301524 TTAATTTGGAAAATATTTAAAGG - Intergenic
1186133727 X:6496693-6496715 CTAATTCAAAAGATCTTTCTTGG + Intergenic
1186435626 X:9540613-9540635 CTAAGTCAGCACATATTTGAAGG - Intronic
1186842816 X:13501999-13502021 CTAATTCAGAAGTTATATAAAGG + Intergenic
1186873650 X:13796383-13796405 CTAATATAGAAAATATTTATAGG + Intronic
1187541585 X:20201641-20201663 TTAATTCATAAGTTAATTAATGG - Intronic
1187616310 X:20997731-20997753 CTAATTCAAAGCTTATTTAAAGG + Intergenic
1187631233 X:21174976-21174998 CTAATTCAGGAGCTATTGTAGGG + Intergenic
1188076632 X:25784770-25784792 CTAATTCTGAATAAGTTTAAAGG - Intergenic
1188167791 X:26883559-26883581 CTAATTCAAAGCTTATTTAAAGG - Intergenic
1188236331 X:27736139-27736161 CTGATTCAGGAAATATTGAAGGG - Intronic
1188814151 X:34690427-34690449 CTGATTCTGCAGAAATTTAAAGG - Intergenic
1188876591 X:35438093-35438115 CTAATTCAGAGCTTATTTAAAGG - Intergenic
1188908578 X:35818285-35818307 CTAATTCAGAAGTTATCTAAAGG - Intergenic
1189026218 X:37397694-37397716 CCAGTTCAAAACATATTTAAGGG + Intronic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1189151352 X:38710903-38710925 CAAATTCTGCAGATATTGAAAGG + Intergenic
1189550900 X:42092139-42092161 CTAATTCAAAGCTTATTTAAAGG - Intergenic
1190956257 X:55197102-55197124 CTAATTCAAAGCTTATTTAAAGG - Intronic
1191625673 X:63268480-63268502 CTAATTCAAAGCTTATTTAAGGG - Intergenic
1192623032 X:72699133-72699155 CTAATTCAAAGCTTATTTAAAGG + Intronic
1192984882 X:76387021-76387043 CTAAATCAGAAGTTATCTAAAGG - Intergenic
1193175883 X:78392057-78392079 CTAATTCAGTGGAAATTCAAAGG + Intergenic
1193472984 X:81929031-81929053 CTAATACAGATGACCTTTAAAGG - Intergenic
1193474980 X:81952379-81952401 CTAATTCAAAGCTTATTTAAAGG + Intergenic
1193487087 X:82099197-82099219 CTAATTCTGCAGAAATTCAAAGG - Intergenic
1193718134 X:84955675-84955697 CTAATTCAAATCTTATTTAAGGG - Intergenic
1193864847 X:86719342-86719364 CAAATTCAAAAGATATTTGGTGG + Intronic
1193915726 X:87361023-87361045 CTAATACAGCAGAAATTCAAAGG + Intergenic
1193958429 X:87892637-87892659 CAAATTCAGTTGATAATTAATGG - Intergenic
1194003911 X:88467017-88467039 CTAATTCAAAGCTTATTTAAAGG + Intergenic
1194152130 X:90338941-90338963 CAAATTAAGAAGTTATTAAAAGG - Intergenic
1194320419 X:92440140-92440162 CTAATTTACAAGATCTTGAATGG + Intronic
1194673245 X:96761836-96761858 TTAATTCAGAAGACTGTTAATGG + Intronic
1195546764 X:106121275-106121297 CTAATTCAGAACATATTTAAAGG - Intergenic
1196776988 X:119347458-119347480 TTCATTCAGCAGATATTTATTGG + Intergenic
1197481162 X:126988168-126988190 CTAATTCAAAGCTTATTTAAAGG + Intergenic
1197638992 X:128947358-128947380 CTAAGTAAGAAGATTTTTTAGGG + Intergenic
1198553674 X:137770256-137770278 CTAGTTTAAAAGATATTTGAGGG + Intergenic
1198554163 X:137775146-137775168 CTAGTTTAAAAGATATTTGAGGG - Intergenic
1198927853 X:141819932-141819954 CTAATTCAGAAGTTATTAAAAGG - Intergenic
1198952303 X:142085152-142085174 CTAATTCAAAGCTTATTTAAAGG + Intergenic
1200285443 X:154817799-154817821 CTAATTCAAAGGTTATTTAAAGG - Intronic
1200456454 Y:3400172-3400194 CTAATCCAGGAGATATATATAGG - Intergenic
1200498480 Y:3915693-3915715 CAAATTAAGAAGTTATTAAAAGG - Intergenic
1200628534 Y:5553278-5553300 CTAATTTACAAGATCTTGAATGG + Intronic
1200949105 Y:8876129-8876151 GTAAGATAGAAGATATTTAATGG + Intergenic
1201580691 Y:15509061-15509083 CTAATTCAAAGCTTATTTAATGG - Intergenic
1201720852 Y:17095139-17095161 CTGATTTAGAAGATATTTTCTGG - Intergenic
1202250138 Y:22861752-22861774 CTCACTCAGTAGATGTTTAAAGG + Intergenic
1202403127 Y:24495500-24495522 CTCACTCAGTAGATGTTTAAAGG + Intergenic
1202467655 Y:25174581-25174603 CTCACTCAGTAGATGTTTAAAGG - Intergenic