ID: 1092994513

View in Genome Browser
Species Human (GRCh38)
Location 12:13935991-13936013
Sequence ACAGTGGCTGCACTGTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 629
Summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 573}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092994510_1092994513 21 Left 1092994510 12:13935947-13935969 CCTAGAGACAATTTCCTGACAGA 0: 1
1: 0
2: 1
3: 16
4: 178
Right 1092994513 12:13935991-13936013 ACAGTGGCTGCACTGTGCTGAGG 0: 1
1: 0
2: 4
3: 51
4: 573
1092994511_1092994513 7 Left 1092994511 12:13935961-13935983 CCTGACAGAGAGCTAGAGTCAAA 0: 1
1: 0
2: 0
3: 11
4: 167
Right 1092994513 12:13935991-13936013 ACAGTGGCTGCACTGTGCTGAGG 0: 1
1: 0
2: 4
3: 51
4: 573

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092994513 Original CRISPR ACAGTGGCTGCACTGTGCTG AGG Intronic
901227970 1:7625379-7625401 ACAGTGGCAGGACTGCTCTGTGG + Intronic
901273056 1:7968581-7968603 GCAGAGGCTGCAGTGAGCTGAGG - Intronic
901315397 1:8304084-8304106 ACAGTGGATGCTTTGTGATGTGG + Intergenic
901674398 1:10874523-10874545 TCAGTCTCAGCACTGTGCTGAGG - Intergenic
902057022 1:13609598-13609620 ACAGTGGCTGCCAGGGGCTGGGG - Intronic
902517779 1:16998943-16998965 ACAGTGGCTGCCCTGGGGAGGGG + Intronic
903116462 1:21182518-21182540 ACAGAGGCTGCACTGGGCTCTGG - Intergenic
903181080 1:21605097-21605119 GCAGTGGGTGCAGTGTCCTGGGG + Intronic
903783021 1:25834547-25834569 ACAGAGGGTGCAGTGAGCTGAGG + Exonic
904338933 1:29820173-29820195 CCAGTGTTTGCACTGGGCTGGGG - Intergenic
905038922 1:34936551-34936573 ACAGAGGTTGCAGTGAGCTGAGG + Intergenic
905192807 1:36248966-36248988 AAAGAGGCTGCAGTGAGCTGAGG - Intronic
905917080 1:41692353-41692375 ACAGTAGCTCCCCTGTGCTTGGG - Intronic
906313364 1:44769625-44769647 GCAGAGGCTGCAGTGAGCTGAGG + Intergenic
906586774 1:46985116-46985138 ACAGTGGCTTTGCTGAGCTGTGG - Intergenic
907403995 1:54242535-54242557 ACAGTGGCTACACTGTCCAGAGG + Intronic
907597755 1:55735350-55735372 CCAGAGCCTTCACTGTGCTGAGG + Intergenic
907953565 1:59206892-59206914 ACAGTGGCTTTGCTGAGCTGTGG - Intergenic
909445352 1:75742979-75743001 ACAGAGGCTGCTCTGAGCTTGGG + Intronic
909691219 1:78409739-78409761 AGAGCTTCTGCACTGTGCTGGGG - Intronic
909700289 1:78514167-78514189 ACAGTGGCTGTACCATTCTGGGG - Intronic
909992445 1:82239873-82239895 ACAGCCACTGCAGTGTGCTGTGG + Intergenic
910231866 1:84996479-84996501 ACTTTGGCTCAACTGTGCTGGGG + Intronic
910513782 1:88036316-88036338 GAGGTGGCTGCACTGTGCTGGGG - Intergenic
910777009 1:90886896-90886918 ACAGAGGGTGGATTGTGCTGGGG + Intergenic
911299447 1:96154307-96154329 CCAGTGGCTGCACTTAGCTTTGG - Intergenic
912558227 1:110531523-110531545 ACAGAGGCTGCCCTGTGCATAGG - Intergenic
913130569 1:115834931-115834953 ACTGTGTCTGCGCTGTGCTCAGG + Intergenic
915223993 1:154398293-154398315 GCAGAGGCTGCATTATGCTGTGG - Intergenic
915611818 1:156999807-156999829 ACAGTGGCTACGATGTGGTGAGG - Intronic
915927917 1:160038298-160038320 ACAGTGGCAGGACGCTGCTGGGG + Exonic
917259154 1:173148458-173148480 AGAGTGGCTGTGCTGTGCTGTGG + Intergenic
917957137 1:180111023-180111045 ACAGTGGGTGAACTATGATGAGG + Exonic
918786365 1:188769210-188769232 ACAGCTGCTGTGCTGTGCTGTGG - Intergenic
919231420 1:194779554-194779576 ACAGTTGCTGTGCTGCGCTGTGG - Intergenic
919405352 1:197174318-197174340 ACAGTGGCTGGAATGTGAAGTGG + Intronic
922765025 1:228152158-228152180 ACAGTGCCTGCCATGCGCTGGGG + Intronic
923417643 1:233779766-233779788 GCAGAGGCTGCAGTGAGCTGAGG - Intergenic
923516056 1:234698798-234698820 ACAGTGTCAGCAAAGTGCTGTGG - Intergenic
923534829 1:234841020-234841042 ACAGTGGCTGAGCTGAGCTGGGG + Intergenic
923539338 1:234876992-234877014 GCAGAGGCTGCAGTGAGCTGGGG - Intergenic
924412376 1:243819609-243819631 GGAGGGGATGCACTGTGCTGGGG - Intronic
924530783 1:244892015-244892037 ACAGAGGCTGCAGTGAGCTGAGG - Intergenic
924844237 1:247749632-247749654 ACAGGGGCTGGTCTGAGCTGTGG - Intergenic
924927748 1:248699633-248699655 ACAGTGGACTCACTGAGCTGAGG + Intergenic
1062800324 10:374390-374412 ACACTGGCTGTATTGTGTTGTGG + Intronic
1063077713 10:2733189-2733211 ACAGCGGCTACACCGGGCTGAGG + Intergenic
1063226047 10:4015975-4015997 ACGGAGGCTGCAGTGAGCTGAGG + Intergenic
1064228618 10:13509354-13509376 ACTGTGGGTGCCCAGTGCTGGGG - Intronic
1064370373 10:14747555-14747577 AGGGTGGCTGCAGTTTGCTGGGG + Intronic
1064453318 10:15463867-15463889 GCAGTGTCTGCACAATGCTGGGG - Intergenic
1065051776 10:21799874-21799896 ACAGTGCCTTCACAGTGCTCAGG - Intronic
1065150766 10:22820669-22820691 GCAATGGCTCAACTGTGCTGTGG - Intergenic
1066037618 10:31508957-31508979 ACAGTGGCAGCAGTCTGTTGGGG + Intronic
1067382627 10:45789024-45789046 CCACTGGCTGCTCTGAGCTGTGG - Exonic
1067700700 10:48569281-48569303 GCACTGGCTGCATTTTGCTGAGG + Intronic
1067747906 10:48950214-48950236 ACAGTGGTTGCTGGGTGCTGTGG - Intronic
1067890330 10:50129572-50129594 CCACTGGCTGCTCTGAGCTGTGG - Exonic
1069093452 10:64229680-64229702 ACAGTGGCTTTGCTGAGCTGTGG + Intergenic
1070551129 10:77491553-77491575 GCAGTGGCTCCAATTTGCTGAGG + Intronic
1072404081 10:95133288-95133310 AGAGTGACTTCACTGTGATGAGG + Intergenic
1072493821 10:95934936-95934958 ACAGAGGTTGCAGTGAGCTGAGG - Intronic
1072694870 10:97595625-97595647 ACAGAGGCTGCAGTGAGCCGAGG + Intronic
1072732965 10:97860418-97860440 ACAGAGGCTGCAGGGAGCTGTGG - Intronic
1073347900 10:102798490-102798512 GCAGAGGCTGCAATGAGCTGAGG - Intronic
1074483047 10:113844866-113844888 GCAGAGGCTGCAGTGAGCTGAGG + Intronic
1075731958 10:124641677-124641699 ACAGTGGATCCAGTGTGTTGGGG - Intronic
1075860789 10:125674944-125674966 AAAGTGGGTGCATTGAGCTGGGG + Intronic
1076641784 10:131921667-131921689 TCACTGGCTGCAGTGTGCGGAGG + Intronic
1076869680 10:133187239-133187261 CCAGGGGCAGCACTGGGCTGGGG - Intronic
1077118399 11:895767-895789 TCAGAGGCAGGACTGTGCTGAGG + Intronic
1077195040 11:1275323-1275345 TCAGAGGCCTCACTGTGCTGGGG - Exonic
1077496899 11:2890890-2890912 ACAGGGACTGCCTTGTGCTGGGG + Intronic
1078525127 11:12094790-12094812 ACAGAGGTTGCAGTGAGCTGAGG + Intronic
1078998362 11:16727996-16728018 ACAGTGGCTTTGCGGTGCTGAGG - Intronic
1079262521 11:18897338-18897360 ACAGTGGGTGTGCTGAGCTGTGG + Intergenic
1079622159 11:22567655-22567677 AAGGTGGCTGCTCTGTGCTGGGG + Intergenic
1079668478 11:23136027-23136049 ACAGCAGCTGTATTGTGCTGGGG + Intergenic
1079869521 11:25780588-25780610 GGGGTGGCTACACTGTGCTGGGG - Intergenic
1080878244 11:36296133-36296155 ACAGCGGCTGCTCTGTGTGGTGG - Intergenic
1081067519 11:38564296-38564318 ACAGAGGTTGCAGTGAGCTGAGG - Intergenic
1081198234 11:40186952-40186974 AGAGTGGCAGGGCTGTGCTGGGG + Intronic
1082938716 11:58680826-58680848 GTAGTGACTGCATTGTGCTGGGG - Intronic
1083155536 11:60820744-60820766 GCAGTGGCTGCACAGGTCTGTGG - Intergenic
1083363631 11:62128433-62128455 ACTGTGTGTGCAGTGTGCTGGGG + Intronic
1083628011 11:64081864-64081886 CCAGTGGCTGCTCGGTGGTGGGG + Intronic
1083920415 11:65779217-65779239 ACTGTGCCTGCTCTGTGCCGAGG - Exonic
1084727314 11:70950124-70950146 ACAGAGGTTGCAGTGAGCTGAGG - Intronic
1085335119 11:75687645-75687667 AGAGCTGGTGCACTGTGCTGGGG + Intergenic
1085590421 11:77754674-77754696 ATGGTGGCTGCAGTGAGCTGAGG + Intronic
1086019206 11:82206061-82206083 GCAGAGGCTGCAGTGAGCTGAGG - Intergenic
1086860051 11:91915404-91915426 TCAGTGGCTCCACTGGTCTGGGG + Intergenic
1087695276 11:101369538-101369560 ACAGTGGCTTTGCTGAGCTGTGG + Intergenic
1088632097 11:111783388-111783410 ACAGAGGTTGCAGTGAGCTGAGG + Intronic
1089965493 11:122651960-122651982 GCAGAGGCTGCAGTGAGCTGAGG - Intergenic
1090768689 11:129899081-129899103 ACAATGGCTGGAATGGGCTGGGG + Intergenic
1091273586 11:134334293-134334315 ACAGTGGCTGGCATGGGCTGGGG + Intronic
1091831309 12:3552852-3552874 ACAGAGGCTGGCCTGTGCTAAGG - Intronic
1092007644 12:5083120-5083142 CCACTGGCTGCACAGTCCTGAGG - Intergenic
1092994513 12:13935991-13936013 ACAGTGGCTGCACTGTGCTGAGG + Intronic
1093336025 12:17905786-17905808 ACAATGGCTGTGCAGTGCTGAGG + Intergenic
1093528759 12:20136031-20136053 AGAACTGCTGCACTGTGCTGGGG + Intergenic
1094140012 12:27171606-27171628 ACAGTGGCTTTGCTGAGCTGTGG + Intergenic
1095247848 12:39943486-39943508 ACAGTGGCTTTGCTGAGCTGTGG + Intronic
1095356445 12:41280621-41280643 ACAGTGGCTTTGCTGAGCTGCGG - Intronic
1095480564 12:42630775-42630797 ACAGGGGTTGCAGTGAGCTGAGG - Intergenic
1095631592 12:44383169-44383191 ACTGTGGATGAGCTGTGCTGTGG - Intronic
1095824384 12:46516353-46516375 AGAATAGCTGCATTGTGCTGAGG + Intergenic
1096528128 12:52225881-52225903 ACACTGGCTGCCCTCTGCAGAGG + Intergenic
1097517018 12:60618417-60618439 AGAGCTGGTGCACTGTGCTGGGG - Intergenic
1098829959 12:75350094-75350116 ACAGTGGCTGTGCTGTGCTGTGG - Intronic
1098906630 12:76169589-76169611 ACAGTGGCTTTGCTGAGCTGCGG + Intergenic
1101137838 12:101763737-101763759 ACCATGGCTTCACTGTGCTGTGG - Intronic
1101186859 12:102289546-102289568 AGAGGGGGTGCGCTGTGCTGGGG + Intergenic
1101837120 12:108303434-108303456 ACAGTGGCTGGACTGTAGTGAGG - Intronic
1102925351 12:116821900-116821922 GCAGAGGCTGCAGTGGGCTGAGG - Intronic
1102944120 12:116970433-116970455 ACTGTGGCTGCCCTGGGCGGAGG + Intronic
1103169134 12:118798875-118798897 ACAGCTGCTTTACTGTGCTGTGG + Intergenic
1103399304 12:120632082-120632104 ACGGTGGCTGGAATGTGGTGGGG + Intergenic
1103576408 12:121880860-121880882 GCAGTGGTTGCAGTGAGCTGAGG - Intergenic
1103929339 12:124440949-124440971 CCTGTGGCTGGACAGTGCTGGGG + Intronic
1104256294 12:127142602-127142624 AGGGTGGCTGCAATTTGCTGGGG + Intergenic
1105996394 13:25676494-25676516 ACAAGGGCTGCAATGTCCTGAGG - Intronic
1106269128 13:28137706-28137728 ACAGGTGCTGCACTGAGCAGGGG + Intergenic
1106379977 13:29227189-29227211 GCAGAGGCTGCAGTGAGCTGAGG + Intronic
1106983838 13:35321828-35321850 ACAGTGGCTTTGCTGAGCTGCGG + Intronic
1107175544 13:37394675-37394697 AGCGTGGCTGCATTTTGCTGGGG - Intergenic
1108181240 13:47841908-47841930 ACAGGGGCTCCACTATGCTGGGG + Intergenic
1110060547 13:71033497-71033519 ATAGAAGCTGTACTGTGCTGGGG - Intergenic
1110317025 13:74120410-74120432 ACAGAGGTTGCAGTGAGCTGAGG + Intronic
1111785261 13:92777763-92777785 ACTGTGTCTCCACTGTGCTCTGG - Intronic
1111981099 13:95016451-95016473 ACAGAGGCTGCAGTGAGCCGAGG - Intergenic
1112378897 13:98869858-98869880 CCACTGCCTGGACTGTGCTGTGG + Intronic
1112513106 13:100027628-100027650 ACAGAGGTTGCAGTGAGCTGAGG + Intergenic
1112578981 13:100662284-100662306 GCGGTGCCTGCACTCTGCTGGGG - Intronic
1112790710 13:102999733-102999755 ACAGAGACTGCACAGTGGTGAGG - Intergenic
1112968690 13:105232099-105232121 GCAGTTGCTGCACCGTGCGGTGG - Intergenic
1113171305 13:107506560-107506582 ACAGTGGCTGCCTTGAGCTGGGG - Intronic
1113946556 13:114047832-114047854 GCAGTGGCTGCCCGGGGCTGTGG + Intronic
1114058907 14:19001328-19001350 AGCGTGGCTGTGCTGTGCTGAGG - Intergenic
1114103637 14:19400426-19400448 AGCGTGGCTGTGCTGTGCTGAGG + Intergenic
1114278547 14:21169524-21169546 AAGGTGGGTGCTCTGTGCTGGGG - Intergenic
1114397387 14:22378128-22378150 ACAGTGTCAGCACTGTCCAGAGG - Intergenic
1114526436 14:23369629-23369651 AAAGTGGTAGCACTGTTCTGGGG + Intergenic
1114817690 14:25979569-25979591 ACAGTGGCTTCGCTGAGCTGTGG - Intergenic
1115912136 14:38268688-38268710 ACAGTGGCTTTGCTGAGCTGTGG + Intergenic
1116312274 14:43342159-43342181 AGAGCTGGTGCACTGTGCTGGGG + Intergenic
1116968946 14:51044653-51044675 ACAGTGGCTGCACTGTCATCCGG - Intronic
1117392883 14:55279216-55279238 ACGGAGGCTGCAGTGAGCTGAGG + Intronic
1117436368 14:55718521-55718543 AAAGTTGCTTCTCTGTGCTGAGG + Intergenic
1118081082 14:62361657-62361679 ATGGTGGCTGAACTGTGCTTGGG - Intergenic
1118659910 14:67996873-67996895 ACAGTGGAGGCAGTGAGCTGTGG + Intronic
1118957571 14:70497143-70497165 AGAGTGGCTGTACTGTTCTGGGG - Intergenic
1119018461 14:71084578-71084600 ACAGTGGCTTTGCTGAGCTGTGG + Intronic
1119048330 14:71340869-71340891 GCAGAGGCTGCAGTGAGCTGTGG + Intronic
1119054358 14:71403999-71404021 ACAGTCTCTTCACTGTGATGTGG - Intronic
1119471461 14:74902749-74902771 ACAGAGGCTGCTCTGAGCTTGGG - Exonic
1119614154 14:76087463-76087485 ACAGTGCCTGCAGTTTGCTAGGG + Intergenic
1119703900 14:76772429-76772451 CCTGTGGCTGCTGTGTGCTGGGG + Intronic
1120679265 14:87460525-87460547 GCAGAGGCTGCAGTGAGCTGAGG - Intergenic
1121142458 14:91555254-91555276 AGAGAGGGTGCACAGTGCTGGGG - Intergenic
1121208918 14:92191802-92191824 ACAGTGACTGCACAGTGTGGCGG - Intergenic
1121435060 14:93913707-93913729 CCAGAGGCTGCTCTGTGCAGGGG + Intergenic
1121678605 14:95774494-95774516 ACAGAGGGTGCACTGCTCTGAGG - Intergenic
1121919739 14:97869484-97869506 AGAGAGGCAGCAATGTGCTGTGG - Intergenic
1122197167 14:100097151-100097173 GCAGTCACTGCACTTTGCTGGGG - Intronic
1122422105 14:101584110-101584132 GCAGTGGCTGGACTGGGCCGCGG + Intergenic
1124642347 15:31403689-31403711 ACAGGGGCTACACTGTGATGGGG - Intronic
1125545058 15:40497405-40497427 CCAGTGACTTCAATGTGCTGGGG - Intergenic
1127442019 15:59018989-59019011 GCAGAGGCTGCAGTGAGCTGAGG - Intronic
1127788696 15:62378962-62378984 GCCTTGGCTGCACTGTGATGGGG + Intergenic
1128053280 15:64681995-64682017 GCAGTGGCTTCTCTGGGCTGAGG - Exonic
1128180147 15:65595138-65595160 TCAGGGGTGGCACTGTGCTGTGG - Intronic
1128199623 15:65793196-65793218 ACAGAGGGTGCACAGTGGTGAGG + Intronic
1128202742 15:65823344-65823366 GCAGAGGCTGCAGTGAGCTGAGG + Intronic
1128252077 15:66170799-66170821 ACAGGGGCTGCAGTCAGCTGAGG - Intronic
1128371528 15:67043267-67043289 ATAGAGGCTGCAATGAGCTGAGG - Intergenic
1128577666 15:68787412-68787434 CCAGTGGCTCTATTGTGCTGAGG + Exonic
1128924063 15:71637791-71637813 GCAGAGGTTGCACTGAGCTGAGG - Intronic
1129499132 15:76019063-76019085 ACAGTGGCTTTGCTGAGCTGCGG + Intronic
1130305459 15:82709830-82709852 GCAGAGGCTGCAGTGTGCAGCGG + Intronic
1130984712 15:88837237-88837259 ACACTGACTGCACTGTGAGGGGG - Intronic
1132215243 15:100057508-100057530 ACACGGGCTGCCCTGAGCTGGGG + Intronic
1132670655 16:1100978-1101000 TCCGTGGCTGGGCTGTGCTGTGG + Intergenic
1133143013 16:3762142-3762164 ACAGTGGCAGCACTGAGGAGTGG + Intronic
1133340175 16:5030813-5030835 AAAGTGGCTGCAGGGTGGTGAGG - Intronic
1133815601 16:9195155-9195177 GCAGAGGCTGCAGTGGGCTGAGG + Intergenic
1133823701 16:9259080-9259102 AGTGTGGCTGCCTTGTGCTGAGG + Intergenic
1133834309 16:9352375-9352397 CCAGCAGCTGCACTGTGGTGTGG - Intergenic
1134510972 16:14846579-14846601 CCAGGGGCTGCCCTTTGCTGAGG - Exonic
1134698615 16:16245070-16245092 CCAGGGGCTGCCCTTTGCTGAGG - Exonic
1134785211 16:16935968-16935990 GCAGAGGTTGCACTGAGCTGAGG + Intergenic
1134973220 16:18549603-18549625 CCAGGGGCTGCCCTTTGCTGAGG + Exonic
1135091310 16:19520332-19520354 ACAGAGGTTGCAGTGAGCTGGGG + Intronic
1135105073 16:19642140-19642162 GCAGGGGCTGCAGTGAGCTGAGG + Intronic
1135551016 16:23398380-23398402 ACATTGGCTGAACTGTGGGGTGG + Intronic
1135556511 16:23441505-23441527 GCAGAGGCTGCATTGAGCTGAGG + Intronic
1136135775 16:28256111-28256133 CCAATCGCTGCACTGTGCAGAGG - Intergenic
1136264998 16:29110916-29110938 ACTGTGGCCGCCCTGAGCTGGGG - Intergenic
1136265181 16:29112438-29112460 ACTGTGGCCGCCCTGAGCTGGGG + Intergenic
1136776437 16:32874252-32874274 AGGGTGGGAGCACTGTGCTGCGG - Intergenic
1136894178 16:33987260-33987282 AGGGTGGGAGCACTGTGCTGCGG + Intergenic
1137052932 16:35728554-35728576 ACAATGCCTGCAGTTTGCTGAGG + Intergenic
1138373886 16:56549165-56549187 CAAGTGGCTGCACTCTGCTGTGG - Intergenic
1138886934 16:61091178-61091200 ACAGTGGCTTTGCTGAGCTGTGG - Intergenic
1139953554 16:70683063-70683085 ACAGTGGCTGCTCTGGAGTGGGG + Intronic
1140182716 16:72736356-72736378 ACAGCTGCTGTGCTGTGCTGTGG + Intergenic
1141570746 16:84932202-84932224 GCAGTGGCTGCAGGGAGCTGCGG + Intergenic
1141574125 16:84953244-84953266 ATATTTGCTGCTCTGTGCTGGGG - Intergenic
1141748895 16:85945186-85945208 TCTGTGGCTGCCCTGTGCTGGGG + Intergenic
1142053791 16:87978891-87978913 ACTGTGGCCGCCCTGAGCTGGGG - Intronic
1142053981 16:87980413-87980435 ACTGTGGCTGCCCTGAGCTGGGG + Intronic
1203078852 16_KI270728v1_random:1136361-1136383 AGGGTGGGAGCACTGTGCTGCGG - Intergenic
1203139965 16_KI270728v1_random:1756550-1756572 ACAGTGGCAGCTCAGAGCTGGGG + Intergenic
1142831840 17:2554884-2554906 GCAGAGGCTGCAGTGAGCTGAGG + Intergenic
1142870486 17:2816814-2816836 ATGGTGGCTGCAGGGTGCTGTGG - Intronic
1144117718 17:12115815-12115837 ACAGGAGCTGCACTGTGCGATGG + Intronic
1144431775 17:15198910-15198932 ACAGCTGCTGTGCTGTGCTGTGG - Intergenic
1144835719 17:18155680-18155702 ACAGCAGCAGCACTGTGCAGAGG + Intronic
1144933468 17:18878935-18878957 ACAGTGGTTGCAGTGAGCCGAGG - Intronic
1145946607 17:28780218-28780240 AAAGTGGCTGGAGTGGGCTGAGG - Intronic
1145966586 17:28923021-28923043 ACAGAGGCTGCACTGCACTGTGG - Intronic
1146838119 17:36128551-36128573 ACAGAGGCTGGGCTGTTCTGTGG - Intergenic
1147525283 17:41216576-41216598 ACAGTGGCTTTGCTGTGCTGAGG - Intronic
1147815510 17:43206995-43207017 GCAGAGGCTGCAGTGAGCTGAGG + Intronic
1147926648 17:43950751-43950773 ACAGTGGCTGCCCTGAGCTTTGG - Intergenic
1148370360 17:47095094-47095116 GCAGAGGCTGCAGTGAGCTGAGG + Intergenic
1150377704 17:64695487-64695509 GCAGAGGTTGCAGTGTGCTGAGG + Intergenic
1152316448 17:79583429-79583451 ACAGTGACTGCACTCAGCTGGGG + Intergenic
1152338421 17:79710814-79710836 ACAGAGGCTGCAGTGAGCCGAGG - Intergenic
1152596825 17:81241873-81241895 GCAGAGGCTGCACTTTCCTGGGG + Intergenic
1153313395 18:3699869-3699891 ACAGTGGCTTTGCTGAGCTGCGG + Intronic
1153491045 18:5648135-5648157 GCAGAGGCTGCAGTGAGCTGAGG + Intergenic
1153563320 18:6394103-6394125 GTAGTGGCAGCACTGGGCTGGGG - Intronic
1153798484 18:8647134-8647156 ACAGTGGCTTTGCGGTGCTGCGG - Intergenic
1153931841 18:9885992-9886014 AAGGTGGCTCCCCTGTGCTGAGG - Exonic
1154101527 18:11479163-11479185 ACAGTGGCTTTGCTGCGCTGCGG + Intergenic
1154228050 18:12526406-12526428 CCAGTGGGTGCAGGGTGCTGTGG - Intronic
1154454826 18:14511042-14511064 AGGGTGGCTGTTCTGTGCTGAGG + Intronic
1155429886 18:25744051-25744073 AGAGAGGGTGCACTCTGCTGGGG - Intergenic
1155500186 18:26479796-26479818 AGATTGGCAGGACTGTGCTGTGG + Intronic
1156245646 18:35295304-35295326 ACAGTGGATGCCCTTTGGTGAGG + Intergenic
1156683510 18:39618381-39618403 ACAGGGGCTCCACAGTGCAGCGG - Intergenic
1156939069 18:42742843-42742865 ACAGTGAAGGCACTGAGCTGTGG - Intergenic
1157171836 18:45414255-45414277 ACAATTGCTGGACTGAGCTGAGG + Intronic
1157614080 18:48976468-48976490 ACAGTGGCTTCATTGTTCGGCGG - Intergenic
1158602239 18:58864559-58864581 ACAGTGTCTGCGGTGGGCTGTGG + Intronic
1158676986 18:59529256-59529278 ACAGCTGCTGTGCTGTGCTGTGG + Intronic
1160087251 18:75788098-75788120 CCAGAGGCTGTACTGAGCTGTGG + Intergenic
1160995645 19:1880917-1880939 ACAGGGGCTGCCCTGGCCTGCGG - Exonic
1161498310 19:4599023-4599045 ACAGAGGCTGCGCTGTTCTCTGG + Intergenic
1163120697 19:15215709-15215731 CCAGTGGCTTCACTGTGCTTGGG - Intergenic
1163293545 19:16396925-16396947 ACAGTGGCTGCCAGGGGCTGTGG + Intronic
1163718603 19:18886868-18886890 ACAGTGCCTGGACTGGGGTGGGG - Intronic
1165530453 19:36395961-36395983 GCAGAGGCTGCAGTGAGCTGAGG - Intronic
1165618670 19:37225517-37225539 ACAGTGGCTGCCAGGGGCTGGGG - Intronic
1165709604 19:38000803-38000825 ACAGTGGTTGCCCTTTGGTGGGG + Intronic
1166735884 19:45084468-45084490 CCAGAGGCTGCAGTGAGCTGAGG - Intronic
1166848579 19:45746034-45746056 GCAGAGGCTGCAGTGAGCTGAGG - Intronic
1167119503 19:47508085-47508107 GCAGAGGCTGCTCTCTGCTGGGG + Intronic
1167594973 19:50422737-50422759 ACAATGGCCTCTCTGTGCTGGGG + Intronic
1168126532 19:54286409-54286431 TCAGGGTCTGCACTGGGCTGAGG + Intergenic
1168142812 19:54400569-54400591 GCAGAGGCTGCAGTGAGCTGAGG + Intergenic
1168175361 19:54624454-54624476 TCAGGGTCTGCACTGGGCTGAGG - Intronic
1168474678 19:56667345-56667367 CCTGTGGATCCACTGTGCTGGGG + Intronic
925079977 2:1056238-1056260 GGAGAGGCCGCACTGTGCTGTGG + Intronic
925355736 2:3239731-3239753 TGAGTGTCTGCACCGTGCTGAGG - Intronic
927198327 2:20563345-20563367 ACAGAGGCAACACTGTGCAGTGG - Intronic
928462286 2:31485877-31485899 ATAGCAGTTGCACTGTGCTGAGG + Intergenic
928514351 2:32031527-32031549 GCAGTGGTTGCAGTGAGCTGAGG + Intronic
929088334 2:38190511-38190533 TCTGTGGCTGCTGTGTGCTGGGG + Intergenic
929129082 2:38548542-38548564 GCAGAGGCTGCAGTGAGCTGAGG - Intergenic
929256116 2:39813405-39813427 ACAGTGGCTTTGCCGTGCTGTGG + Intergenic
929321838 2:40553377-40553399 AGACTTGCTGGACTGTGCTGAGG - Intronic
929921204 2:46172757-46172779 AGAGGGGATGCCCTGTGCTGGGG + Intronic
930431157 2:51278303-51278325 GCAGAGGCTGCAGTGGGCTGAGG - Intergenic
930455692 2:51605423-51605445 GGAGTGGGTGCACTGTGCTAGGG + Intergenic
932523413 2:72437630-72437652 ACAGTGGCTTTGCTGAGCTGTGG + Intronic
933436445 2:82256545-82256567 AGGGTGGCTGCAGTTTGCTGGGG + Intergenic
934810422 2:97272330-97272352 ACAGCAGCTGTGCTGTGCTGGGG - Intergenic
934827270 2:97435609-97435631 ACAGCAGCTGTGCTGTGCTGGGG + Intergenic
935012798 2:99151393-99151415 GCGGAGGCTGCACTGAGCTGAGG + Exonic
935627669 2:105184712-105184734 ACAATGGTTGCCCTTTGCTGAGG - Intergenic
935749918 2:106222733-106222755 ACAGAGGTTGCACTGAGCCGAGG - Intergenic
935952610 2:108344895-108344917 AAAGGGGGTGCACTGTGCTGGGG + Intergenic
937207537 2:120246202-120246224 ACAGAGGCTGCATGGTGCTTTGG + Intronic
937807300 2:126161181-126161203 ACAGTGGCTTTGCTGAGCTGTGG - Intergenic
938081392 2:128372136-128372158 CCAGGGGCTCCAGTGTGCTGGGG + Intergenic
938282285 2:130072905-130072927 AGCGTGGCTGTGCTGTGCTGAGG + Intergenic
938332726 2:130460305-130460327 AGAGCGGCTGTGCTGTGCTGGGG - Exonic
938332915 2:130461477-130461499 AGCGTGGCTGTGCTGTGCTGAGG + Exonic
938356894 2:130659194-130659216 AGCGTGGCTGTGCTGTGCTGAGG - Intergenic
938433330 2:131266000-131266022 AGCGTGGCTGTGCTGTGCTGAGG - Intronic
938477372 2:131628588-131628610 AGCGTGGCTGTGCTGTGCTGAGG - Intergenic
938568087 2:132538796-132538818 ACAGCTGCTTCGCTGTGCTGTGG + Intronic
938984414 2:136560090-136560112 CCAGTGGCTGCACATTCCTGTGG + Intergenic
939180157 2:138794760-138794782 AAAGCAGCTGCACTGTGTTGTGG + Intergenic
939579239 2:143928704-143928726 TTAGTTGCTGCACTGTGGTGGGG - Intergenic
941885673 2:170524772-170524794 ACCGTGCCTGGCCTGTGCTGAGG + Intronic
941949217 2:171135732-171135754 GCAGAGGCTGCAGTGAGCTGAGG + Intronic
941982005 2:171468843-171468865 TCATTAGCTGCACTGTTCTGGGG - Intronic
943074628 2:183179271-183179293 ACAGTCGCTTTTCTGTGCTGGGG + Intergenic
943548544 2:189311150-189311172 AAAGTGGCTGTGCAGTGCTGGGG - Intergenic
943697988 2:190957156-190957178 ACAGAGGTTGCAGTGAGCTGAGG - Intronic
943950001 2:194121339-194121361 ACAGCTCCTGCAGTGTGCTGCGG - Intergenic
943977403 2:194501844-194501866 GCAGAGGTTGCAGTGTGCTGAGG + Intergenic
944090501 2:195904593-195904615 ACACTGGTAGCACTGTGATGGGG + Intronic
944439363 2:199726936-199726958 AGATGGGATGCACTGTGCTGGGG + Intergenic
944471181 2:200055254-200055276 AAGGCAGCTGCACTGTGCTGGGG - Intergenic
944789983 2:203115193-203115215 GCAGAGGCTGCAGTGAGCTGAGG - Intronic
945101542 2:206266891-206266913 GCAGTGGCTGCCGTCTGCTGGGG + Intergenic
945253647 2:207785663-207785685 ACAGAGGTTGCAGTGAGCTGAGG + Intergenic
945329708 2:208525260-208525282 ACAGTGGCTTTGCTGAGCTGTGG + Intronic
946065294 2:216982436-216982458 ACAGTGGCTTTGCAGTGCTGTGG + Intergenic
946167408 2:217873450-217873472 ACAGGGGCCTAACTGTGCTGTGG + Intronic
946427318 2:219606228-219606250 GCAGTGGCTGCTCGGTGCTCAGG - Exonic
946691613 2:222312466-222312488 GCAGTGGCTGCCCCGGGCTGCGG + Intergenic
946950888 2:224873511-224873533 GCTGCGGCTGCACTGAGCTGAGG + Intronic
947403122 2:229748597-229748619 ACAAAGGCTGCAGTGAGCTGAGG + Intergenic
947550853 2:231045557-231045579 ACCCAGGCTGCACTGTGCAGTGG + Intronic
947646273 2:231743485-231743507 AGAGTGCCTGCAATGTGATGAGG + Intronic
947661611 2:231873590-231873612 GCAGAGGCTGCAGTGAGCTGAGG + Intergenic
948134744 2:235628185-235628207 ACAGTGCCTGACGTGTGCTGGGG - Intronic
1169764688 20:9136375-9136397 ACTGAGGCTCCTCTGTGCTGGGG + Intronic
1170987074 20:21268283-21268305 TCAGTGGCTGGACTGGCCTGAGG - Intergenic
1171119045 20:22552338-22552360 ACAGAGGTTGCAGTGAGCTGAGG + Intergenic
1172164626 20:32891651-32891673 GCACTGGCTGGACTGGGCTGGGG - Intronic
1172548350 20:35779585-35779607 ACAGAGGTTGCAGTGTGCCGAGG - Intronic
1173750165 20:45470082-45470104 TCCGTGGCTGCAGTGGGCTGGGG + Intronic
1174572848 20:51515047-51515069 ACAGTGGTCCCGCTGTGCTGAGG + Intronic
1174796517 20:53527215-53527237 AGAGTGGCTGATGTGTGCTGGGG - Intergenic
1175851755 20:62097544-62097566 ACAGTGGGTGCAGTGAGCAGGGG - Intergenic
1176332445 21:5560711-5560733 ACGTTGGCTGGACTGGGCTGGGG + Intergenic
1176370264 21:6058152-6058174 ACGGTGGCCACACGGTGCTGCGG - Intergenic
1176395312 21:6260240-6260262 ACGTTGGCTGGACTGGGCTGGGG - Intergenic
1176441845 21:6728864-6728886 ACGTTGGCTGGACTGGGCTGGGG + Intergenic
1176466107 21:7055933-7055955 ACGTTGGCTGGACTGGGCTGGGG + Intronic
1176489668 21:7437711-7437733 ACGTTGGCTGGACTGGGCTGGGG + Intergenic
1176721839 21:10400073-10400095 ACAGAGGTTGCAGTGAGCTGAGG - Intergenic
1176819339 21:13642266-13642288 AGGGTGGCTGTTCTGTGCTGAGG - Intergenic
1177536976 21:22440636-22440658 ATTGAGGCTGCACTGAGCTGTGG + Intergenic
1178073770 21:28996800-28996822 GCAGAGGTTGCACTGAGCTGAGG + Intergenic
1178520369 21:33284226-33284248 GCAGAGGCTGCAGTGAGCTGAGG + Intronic
1178592764 21:33925300-33925322 GCAGTGGTTGCAGTGAGCTGAGG - Intergenic
1178911200 21:36674911-36674933 GCAGTGGCTCCACTGGGCAGAGG - Intergenic
1179254628 21:39704622-39704644 ACAGTGGCTTTGCTGCGCTGTGG - Intergenic
1179753255 21:43480389-43480411 ACGGTGGCCACACGGTGCTGCGG + Intergenic
1180165000 21:46020761-46020783 CCAGAGGCGGCACAGTGCTGAGG + Intergenic
1180303027 22:11052850-11052872 ACAGAGGTTGCAGTGAGCTGAGG - Intergenic
1180477391 22:15723944-15723966 AGCGTGGCTGTGCTGTGCTGAGG - Intergenic
1181836869 22:25617606-25617628 TCAGTGGCTGCCCAGGGCTGGGG - Intronic
1181940601 22:26472921-26472943 ACAGGTGCTGGGCTGTGCTGTGG - Exonic
1182119063 22:27775186-27775208 ACAGCGGCTGGAGGGTGCTGTGG + Intronic
1182212053 22:28684896-28684918 CCAGTCTCTGCACAGTGCTGTGG + Intergenic
1183121098 22:35730851-35730873 GCAGAGGCTGCAGTGAGCTGAGG + Intergenic
1183366037 22:37407433-37407455 ACAGTGCTTTCACTGTGATGGGG + Intronic
1183549235 22:38471536-38471558 AGAGTGGCAGGACTGAGCTGAGG - Intronic
1184019126 22:41808769-41808791 ACAGAGGCTGCACTATGTCGGGG + Intronic
1184376820 22:44118886-44118908 ACAGAGGCTGCACAGCTCTGGGG - Intronic
1185264834 22:49895582-49895604 GCAGTGGTTGCAGTGAGCTGAGG + Intergenic
1185284294 22:49993460-49993482 GCGGTGGGTGCACTGGGCTGTGG + Intergenic
949506128 3:4729316-4729338 ACAGTGGCTGGAATGTGATAAGG + Intronic
949606532 3:5659915-5659937 GCAGTGGCTGGAATTTGCTGGGG - Intergenic
949989556 3:9567614-9567636 ACAGAGGTTGCAGTGAGCTGAGG + Intergenic
950418133 3:12880313-12880335 CCAGTGGCTGCACTGGCCTTGGG - Intergenic
950581059 3:13862338-13862360 ACAGTGGCTACACAGGGCGGTGG - Intronic
950947082 3:16960297-16960319 AGTGTGGCGGCACTGTGCTGGGG - Intronic
950995749 3:17494439-17494461 GGAGTGGGTGCACTGTGCTGGGG + Intronic
951293452 3:20902875-20902897 ACAGTAGCTACTGTGTGCTGCGG + Intergenic
951613816 3:24521273-24521295 AGACTGGCTACACTGTCCTGGGG - Intergenic
951795466 3:26533729-26533751 ACAGTGGCTTTGCTGAGCTGTGG + Intergenic
953537092 3:43784690-43784712 ACAGTGGGTGTGCTTTGCTGGGG - Intergenic
954465067 3:50649492-50649514 ACAGGGGCAGCACAGAGCTGGGG - Intergenic
954647205 3:52138899-52138921 ACGGAGGCTGCAGTGAGCTGAGG - Intronic
954654694 3:52186706-52186728 ACAGTGGCTGCTCTGTTTGGAGG - Intergenic
954966786 3:54618927-54618949 TCAGTGGCTGCAGTGTGCCAGGG - Intronic
955681339 3:61505218-61505240 AGAGTGGCTGTGCTGTGCGGGGG + Intergenic
956157870 3:66317638-66317660 AGAGTGGGTGTGCTGTGCTGTGG + Intronic
956386489 3:68725132-68725154 ACAGTAGCTGTGCTGTGTTGTGG + Intergenic
957759552 3:84537524-84537546 ACAATGGCTTGACTGTGGTGGGG + Intergenic
958590585 3:96154150-96154172 AGAGCGGCTGTGCTGTGCTGGGG - Intergenic
959605428 3:108236699-108236721 ACAGCAGCTGTGCTGTGCTGGGG + Intergenic
959957173 3:112252226-112252248 AGAGCAGCTGCACTGTTCTGGGG - Intronic
960218938 3:115079890-115079912 AGAGTGCCTACAATGTGCTGGGG + Intronic
960758721 3:121049178-121049200 AAGGTGGCTGCACTGTGCTAGGG + Intronic
961238656 3:125390707-125390729 ACAGAGGTTGCAGTGAGCTGAGG - Intergenic
961595101 3:128009624-128009646 GCAGAGGCTGCAGTGAGCTGAGG - Intergenic
961684501 3:128620361-128620383 AGGGTGCCTGCACTTTGCTGTGG - Exonic
961700118 3:128737409-128737431 GCAGAGGCTGCAGTGAGCTGGGG - Intronic
961710203 3:128822600-128822622 AGAGAGGCTGCAGTGAGCTGTGG + Intergenic
962263463 3:133929209-133929231 ATAGTGGCCGCACAGGGCTGTGG + Exonic
964629332 3:158792918-158792940 ACAGTGGATGCACTGGGCAAAGG - Intronic
965058340 3:163750003-163750025 GGGGTGGTTGCACTGTGCTGGGG - Intergenic
965511131 3:169568627-169568649 ACAGTGGCTTTGCTGAGCTGCGG - Intronic
966038359 3:175448502-175448524 ACAGTGGCTGGAATGTATTGGGG - Intronic
966151944 3:176875244-176875266 AGAGTTGCTGCACTGTGCTGGGG + Intergenic
966330265 3:178804075-178804097 ATAGTGGCTGAACAGAGCTGTGG - Intronic
966431796 3:179840020-179840042 AGTGTGGCTGCAATGTCCTGTGG + Intronic
966454865 3:180102988-180103010 AGGGTTGCTGCAGTGTGCTGGGG - Intergenic
966973480 3:185065971-185065993 ACAGAGGTTGCAGTGAGCTGAGG + Intergenic
967009767 3:185421784-185421806 ACAGTCTCTTCACTGTGCAGTGG + Intronic
967842924 3:194021380-194021402 TCAGAGGTTGCATTGTGCTGAGG - Intergenic
968127134 3:196168279-196168301 GCAGTGGTTGCAGTGAGCTGAGG + Intergenic
968205634 3:196797393-196797415 GCAGAGGCTGCAGTGAGCTGAGG + Intronic
968696675 4:2033737-2033759 AGTGTGGGTGCACTGCGCTGGGG + Intronic
969431906 4:7160255-7160277 ACAGTGGCTGGACTGGGGAGTGG + Intergenic
969489563 4:7491320-7491342 CCTGAGGCTGCACTGGGCTGGGG + Intronic
970304736 4:14719350-14719372 ACAGTGGCTTCATGGTGCTGCGG - Intergenic
970652100 4:18190225-18190247 ACAGGGACTGCACTGTGCAGTGG + Intergenic
971883263 4:32409772-32409794 ACAGTGGCTTTGCTGAGCTGTGG - Intergenic
972663924 4:41145606-41145628 ACAATGAGTGCACTGTGCTTGGG + Intronic
973366270 4:49211863-49211885 AGTGTGGCTGTGCTGTGCTGAGG + Intergenic
974249250 4:59363079-59363101 AGAGCAGCTGTACTGTGCTGGGG + Intergenic
975335366 4:73169947-73169969 ACACGGGCTGCAGTGTTCTGGGG + Intronic
976394934 4:84545362-84545384 ACAGTGGCTTTCCTGAGCTGTGG - Intergenic
976694024 4:87899329-87899351 ATTGTGGCTGCAGTGAGCTGAGG + Intergenic
977039844 4:92002278-92002300 GGAGTGGGTGCACTGCGCTGGGG - Intergenic
977631453 4:99247925-99247947 ACAGTGGCTTTGCTGTGCTGTGG + Intergenic
978117932 4:105044153-105044175 AAACTGCCTGCAATGTGCTGGGG - Intergenic
978135174 4:105249093-105249115 ACAGAGGTTGCAGTGAGCTGAGG - Intronic
978313299 4:107409699-107409721 ACAGTGGCTTTGCTGAGCTGTGG - Intergenic
978601395 4:110431897-110431919 ACAGTGGCTTTGCTGAGCTGCGG + Intronic
978667939 4:111209132-111209154 ACTGTGGCTGCATTCTGCGGTGG + Intergenic
979461591 4:120990427-120990449 ACAGTGGCTTTGCTGAGCTGTGG + Intergenic
979863459 4:125723605-125723627 GCGGTGGCTGCACAGTGATGGGG + Intergenic
979968449 4:127105930-127105952 AGAGTAGCTGTGCTGTGCTGGGG - Intergenic
979994395 4:127413005-127413027 ACAAAGACTGCTCTGTGCTGGGG - Intergenic
981196822 4:141930410-141930432 CCAGTGGCTGCAATGTATTGTGG - Intergenic
981290681 4:143071405-143071427 ACAGCTGCTGTGCTGTGCTGTGG + Intergenic
982298938 4:153859463-153859485 ACAGTGGCTTTGCTGAGCTGTGG + Intergenic
982323935 4:154109414-154109436 ACAGTGCCTGAGCTGTGCTAAGG + Intergenic
982544041 4:156710734-156710756 ACAGTGGCTCCACTGTGAGCAGG + Intergenic
982639870 4:157945051-157945073 ACTGTGGCTTCACTATGCTATGG + Intergenic
982733435 4:158980113-158980135 ACAGTGGCTTTGCTGAGCTGTGG - Intronic
983044496 4:162969594-162969616 ACAGTGGCTTTGCTGAGCTGCGG + Intergenic
983144559 4:164197396-164197418 TCAGTGGCTCTATTGTGCTGAGG + Intronic
983232697 4:165145611-165145633 AAAGTGTCTGCCCAGTGCTGTGG + Intronic
983820961 4:172193134-172193156 AGAGAGGATGCACTGTGCTGGGG - Intronic
983957642 4:173716170-173716192 AGAGTGGGTGCACTGTGCTTGGG - Intergenic
984466039 4:180101170-180101192 ACGGTGGCTTCAGTGTGCCGGGG + Intergenic
984618666 4:181927431-181927453 ACAGTGGCTTTGCTGAGCTGCGG - Intergenic
985191640 4:187380828-187380850 ACAGAGGTTGCAGTGAGCTGAGG + Intergenic
985520635 5:372587-372609 GCAGTCGCTGCACAGGGCTGGGG + Intronic
985544921 5:504699-504721 ACAGTGGCCTCACAGCGCTGAGG - Intronic
985606737 5:861988-862010 ACCGTGGCTGCTCTGTGCCCTGG + Intronic
985619472 5:946536-946558 TCAGTGCCTGCAGCGTGCTGAGG - Intergenic
985984301 5:3502009-3502031 TCAGTGGCTGCTTTGCGCTGGGG + Intergenic
986669310 5:10128538-10128560 CCATTGGCTGAAGTGTGCTGAGG - Intergenic
987360702 5:17103953-17103975 ACAGTGGGGGCACTTTGCGGGGG + Intronic
988110480 5:26813079-26813101 ACAGCCGCTGTGCTGTGCTGTGG - Intergenic
988805867 5:34739983-34740005 ACAGAGGTTGCAGTGAGCTGAGG + Intronic
989022983 5:37031925-37031947 AGAGTGGCTGCAGGGAGCTGGGG + Intronic
991024911 5:62019079-62019101 ACAGTGTCTACACTGTGCGGGGG - Intergenic
991028851 5:62061452-62061474 GCAGTGACTGAGCTGTGCTGTGG - Intergenic
992426688 5:76664613-76664635 GCAGAGGTTGCAGTGTGCTGAGG + Intronic
992799861 5:80286338-80286360 GCAGAGGCTGCAGTGAGCTGAGG + Intergenic
992982613 5:82192105-82192127 ACAGAGGCTTCACTGTCCAGAGG + Intronic
994235313 5:97356025-97356047 AGAGTAGCTGTGCTGTGCTGGGG + Intergenic
994346832 5:98697394-98697416 ACAGAAGCTGTGCTGTGCTGGGG + Intergenic
994807921 5:104476597-104476619 TCAGAGGCTGCACAGTACTGAGG - Intergenic
995777109 5:115735412-115735434 AGAGTGACTTCACTGTGGTGTGG - Intergenic
996373746 5:122780635-122780657 GCAGAGGCTGCAGTGAGCTGAGG - Intronic
997417708 5:133741712-133741734 ACACTCCCCGCACTGTGCTGTGG + Intergenic
998354364 5:141522441-141522463 TCAGTGGCTTCCCTCTGCTGGGG - Intronic
999156435 5:149460862-149460884 ATAGTGGCTCTACTGTGCTGTGG + Intergenic
999561322 5:152806596-152806618 ACTGTGGCTGCTCTTTGTTGTGG - Intergenic
999938674 5:156516405-156516427 ACAGCTGCTGCAGTTTGCTGGGG - Intronic
1000269784 5:159672960-159672982 ACAGTGGCTCTACTATTCTGGGG - Intergenic
1000698862 5:164422627-164422649 AAAGTGACTGCCCTCTGCTGGGG + Intergenic
1001199304 5:169701580-169701602 GCAGAGGCTGCAGTGAGCTGAGG - Intronic
1001207081 5:169774235-169774257 ACTGTGGCAGCACTGTACTGTGG + Intronic
1002420285 5:179142750-179142772 TCAGTGGCTGCACACTGCAGGGG + Intronic
1002505399 5:179675865-179675887 ACAGGGCCCGCACTGGGCTGTGG + Intergenic
1003812744 6:9803315-9803337 ACAGTGGCTGGTCTGTGCTTTGG + Intronic
1003932850 6:10943040-10943062 ACAGTGGCGGTACTTTGCTAAGG + Intronic
1004927692 6:20431625-20431647 ACAGGGGCTTCATTCTGCTGAGG - Intronic
1005348513 6:24912228-24912250 GGAGTGCCTGCTCTGTGCTGGGG - Intronic
1006965786 6:37983422-37983444 GCAGTGGTTGCAGTGAGCTGAGG - Intronic
1007039862 6:38711668-38711690 ACAGAGGTTGCAGTGAGCTGAGG + Intergenic
1008425207 6:51349039-51349061 ACAGTGGCTTTGCTGTGCTGTGG + Intergenic
1008719168 6:54327875-54327897 ACAGTGGCTTTGCTGTGCTGTGG - Intronic
1009289841 6:61868600-61868622 AAAGCAGCTGCACTTTGCTGGGG + Intronic
1010254472 6:73742188-73742210 ACAGTGGCTGCCAGGGGCTGGGG - Intronic
1011377652 6:86706911-86706933 ACAGCTGCTGTGCTGTGCTGTGG + Intergenic
1012252218 6:96991900-96991922 AAGGTGGCTGCGCTGTGCTGGGG + Intronic
1012293126 6:97483495-97483517 GCAGAGGCTGCAGTGAGCTGAGG + Intergenic
1012780546 6:103551446-103551468 ATGGTGGCTGCACAGGGCTGTGG + Intergenic
1013038012 6:106405292-106405314 ACAGTGGCTCTGCTGAGCTGCGG - Intergenic
1013366994 6:109444122-109444144 ACAGGGGTGGCACTGTGCTGGGG + Exonic
1013420012 6:109959074-109959096 AGAGTGACTGTACTGTGCTGAGG + Intergenic
1014836534 6:126166843-126166865 ACAGTGGCTTCATGGTGCTGCGG + Intergenic
1014956143 6:127618850-127618872 ACACTGGCTCCAATGAGCTGTGG - Intergenic
1015488634 6:133800280-133800302 AGAGCTGTTGCACTGTGCTGGGG + Intergenic
1015494510 6:133865965-133865987 AGAGCGGCTGTGCTGTGCTGGGG + Intergenic
1015623375 6:135156067-135156089 ACGGTGGCTTTGCTGTGCTGCGG + Intergenic
1016402269 6:143693629-143693651 ACAATGGATGCAGTGTGCTTTGG - Intronic
1016590903 6:145742342-145742364 ACAGTGGCTTTGCTGAGCTGTGG - Intergenic
1017536218 6:155350044-155350066 AGAGCTGCTGCGCTGTGCTGGGG + Intergenic
1018897545 6:168030897-168030919 AAAGAAGCTTCACTGTGCTGTGG + Intronic
1019354243 7:570574-570596 AGGGTGACTGCCCTGTGCTGTGG + Intronic
1021166987 7:17354175-17354197 ACAGTGGCTTTGCTGAGCTGAGG + Intergenic
1021776500 7:24059770-24059792 ACAGCGGTTGTGCTGTGCTGTGG - Intergenic
1021862763 7:24923361-24923383 ACAGTGGCTACCCTTTGTTGGGG - Intronic
1021893822 7:25214635-25214657 GCAGAGGCTGCAGTGAGCTGAGG - Intergenic
1022877820 7:34553019-34553041 GCAGTGGCTGCTCAGGGCTGGGG - Intergenic
1023582299 7:41695987-41696009 GCAGTGGATGGACTGGGCTGGGG - Intronic
1024165103 7:46722971-46722993 AGAGCTGCTGTACTGTGCTGGGG - Intronic
1024234076 7:47384717-47384739 GCTGTGACTCCACTGTGCTGAGG - Intronic
1024617059 7:51124886-51124908 ACAGAGGTTGCAATGAGCTGAGG - Intronic
1025259116 7:57405275-57405297 ATAGCGGCTGCACTGCGCTCTGG - Intergenic
1025609736 7:63067879-63067901 ATAGCGGCTGCACTGCGCTCTGG + Intergenic
1026280104 7:68914662-68914684 ATAGTGAATGCACTGTGCTCAGG - Intergenic
1026365414 7:69643650-69643672 ACACTGGCAGTTCTGTGCTGGGG - Intronic
1026999781 7:74644472-74644494 GCAGAGGCTGCAGTGAGCTGAGG - Intergenic
1028082754 7:86599056-86599078 AGAGCAGCTGCGCTGTGCTGAGG - Intergenic
1028082848 7:86599658-86599680 AGAGGAGCTGTACTGTGCTGGGG - Intergenic
1029324734 7:99796445-99796467 ACAGTGGCCTTACTGAGCTGTGG + Intergenic
1029577126 7:101411125-101411147 ACAGCAGCTGCTCTGGGCTGTGG - Intronic
1029578765 7:101420994-101421016 ACAGCGGCTCCACGGTGCTTGGG - Intronic
1029743355 7:102503497-102503519 CCAGTGGCTGCACCTTGCTCTGG + Intronic
1029761344 7:102602658-102602680 CCAGTGGCTGCACCTTGCTCTGG + Intronic
1029837278 7:103326044-103326066 ACAGTGGTTGCAGTGAGCCGAGG - Intronic
1030249270 7:107424203-107424225 ACAGAGGTTGCAGTGAGCTGAGG + Intronic
1030297982 7:107947887-107947909 ACAGTGGCTGAGCTGGGGTGGGG - Intronic
1030375273 7:108746286-108746308 AGAGCTGCTGGACTGTGCTGGGG + Intergenic
1030413591 7:109212940-109212962 AAAGTGGGTGCACTGTGCTGTGG + Intergenic
1032824086 7:135552226-135552248 CCATTTGCTGCATTGTGCTGTGG + Intergenic
1033126293 7:138710163-138710185 ACAGTGGCGGCACACTTCTGTGG - Intronic
1033305867 7:140224967-140224989 GCAGAGGCTGCAGTGAGCTGAGG + Intergenic
1033710314 7:143935968-143935990 ACGGTGGTTGCCCTGTGCTACGG + Exonic
1033712336 7:143960706-143960728 ACAGTGGTTGCCCTGTGCTATGG + Exonic
1033813588 7:145046464-145046486 ACAGAACCAGCACTGTGCTGGGG + Intergenic
1034272372 7:149809420-149809442 GCAGTGGCTGGACTGTGCCCAGG + Intergenic
1034715091 7:153234723-153234745 ACAGTGGCTTTGCTGAGCTGTGG + Intergenic
1034728511 7:153363068-153363090 TCAGTGTCTGCTCTGAGCTGCGG - Intergenic
1034925041 7:155114433-155114455 ACAGTGGGTCCCCTCTGCTGTGG + Intergenic
1035302598 7:157907228-157907250 CCAGTGGCCGCACAGAGCTGTGG - Intronic
1035595990 8:858401-858423 TCAGTGGCTGCCATGGGCTGTGG + Intergenic
1035699906 8:1630831-1630853 TCAGTAGCTGCACTCTGCTTGGG + Intronic
1036556652 8:9865981-9866003 GCAGAGGCTGCAGTGAGCTGAGG - Intergenic
1036789649 8:11709207-11709229 ACCGTGGCCGCGCTGCGCTGTGG + Intronic
1036800006 8:11783711-11783733 GCAGGCGCTGCACTGTGCAGTGG - Intronic
1037536040 8:19825456-19825478 GCAGAGGCTGCAGTGAGCTGAGG + Intronic
1038454953 8:27667051-27667073 CTAGTGGCTGCTCTGAGCTGAGG - Intronic
1039059583 8:33563021-33563043 GCAGAGGCTGCAGTGAGCTGAGG + Intronic
1039069552 8:33637110-33637132 ACAGAGGTTGCAGTGAGCTGAGG - Intergenic
1039223703 8:35364096-35364118 GCAGAGGCTGCACTGAGCTGAGG + Intronic
1040404771 8:47088857-47088879 AGGGTGGCTGTGCTGTGCTGGGG + Intergenic
1040473843 8:47759857-47759879 ACAGTGGCTTTGCTGAGCTGAGG + Intergenic
1041012620 8:53559245-53559267 AGGGCGGCTGCACTGCGCTGGGG - Intergenic
1041026029 8:53688063-53688085 ACATTGGGAGCACTGTGCTCAGG - Intergenic
1041383875 8:57279156-57279178 CCAGTGGCTGCACAGTGCCCAGG + Intergenic
1042012276 8:64260519-64260541 AACGTGGCTGCACTTTGCAGCGG - Intergenic
1042528971 8:69795648-69795670 ACAGTGGATCCACTATTCTGGGG + Intronic
1044125823 8:88457202-88457224 AGAGCAGCTGTACTGTGCTGGGG - Intergenic
1044573402 8:93743907-93743929 ATGGTGGCTGCACTGAGCTGTGG + Intergenic
1045471311 8:102514599-102514621 ACAGAGGCTGCTTGGTGCTGGGG + Intergenic
1045699534 8:104850195-104850217 AGAGTTGCTGTGCTGTGCTGGGG + Intronic
1046047951 8:108986294-108986316 ACAGTGGCTTTGCAGTGCTGTGG + Intergenic
1046255773 8:111694539-111694561 AGGGTGGCTGTTCTGTGCTGGGG + Intergenic
1048161696 8:132027416-132027438 GCAGTCCATGCACTGTGCTGAGG + Intronic
1049553516 8:143271386-143271408 ACAGTAGCTGCCCATTGCTGCGG - Intronic
1052387108 9:27835396-27835418 GGAGGGGCTGCGCTGTGCTGGGG + Intergenic
1052420042 9:28232348-28232370 GCAGAGGTTGCACTGAGCTGAGG + Intronic
1052626345 9:30981450-30981472 AGAGTAGCTGTGCTGTGCTGGGG - Intergenic
1052667986 9:31519110-31519132 ACAGTGGCTTTGCTGAGCTGTGG + Intergenic
1052702952 9:31960058-31960080 AGAGTGACTGTGCTGTGCTGGGG - Intergenic
1054889312 9:70234153-70234175 ACAGTGGGTGCAGTGCACTGAGG + Intergenic
1055145220 9:72925557-72925579 ATAGGGCCTGCACTGAGCTGTGG - Exonic
1055208507 9:73762183-73762205 AGAGCAGCTGTACTGTGCTGGGG - Intergenic
1055239245 9:74163904-74163926 ACAGTGGCTTTGCTGAGCTGTGG - Intergenic
1055373503 9:75624915-75624937 GAGGTGGCTGCACTGTGATGGGG + Intergenic
1057166556 9:92931790-92931812 ACAGTGACTTCATTGTGCTTGGG - Intergenic
1057277890 9:93685945-93685967 AGAGTGTCTGCATTGAGCTGGGG - Intergenic
1058301221 9:103375572-103375594 ATAGAGGCTGCAGTGAGCTGAGG - Intergenic
1058416565 9:104794971-104794993 ACGCTGGATGCACTGTGCTAGGG + Intronic
1058995034 9:110291474-110291496 GCAGAGGCTGCAGTGAGCTGAGG - Intergenic
1059306873 9:113360641-113360663 ACAGCGGGTGCACTGGGCCGAGG + Exonic
1059752881 9:117265270-117265292 ACAGAAGGTGCATTGTGCTGGGG + Intronic
1060224779 9:121784087-121784109 ACAGTGGCTGCTCTGGGAAGGGG + Exonic
1060382675 9:123191382-123191404 AAAGTGGCTGCAGTGAGGTGGGG + Intronic
1060746978 9:126143798-126143820 ACAGAGGTTGCAGTGAGCTGGGG - Intergenic
1061025449 9:128045777-128045799 ACAGAGGTTGCAGTGAGCTGAGG + Intergenic
1061434840 9:130554690-130554712 ACAGAGGCTGCACAGGGATGAGG - Intergenic
1061544637 9:131297451-131297473 ACAGAGGTTGCAGTGAGCTGAGG - Intronic
1062589618 9:137267558-137267580 GCAGAGGCTGCAGTGAGCTGAGG - Intronic
1203429648 Un_GL000195v1:79621-79643 ACGTTGGCTGGACTGGGCTGGGG - Intergenic
1203528019 Un_GL000213v1:107304-107326 AGGGTGGCTGTTCTGTGCTGAGG + Intergenic
1203360347 Un_KI270442v1:216324-216346 ACAGTGGCTGCACCGAGTTTAGG + Intergenic
1186197014 X:7119348-7119370 ACAGTGACAGCACGGTGCTGTGG - Intronic
1186262256 X:7791930-7791952 CCAGTGGCTGCACTGAGGGGTGG - Intergenic
1187729040 X:22234497-22234519 ACAGTGGCCGTGCTGAGCTGTGG + Intronic
1189413198 X:40791748-40791770 ACAATGGCTCCGCTTTGCTGGGG - Intergenic
1189590665 X:42507439-42507461 ACAGTGGCTTTGCTGAGCTGTGG - Intergenic
1189940151 X:46112928-46112950 ACAGTTGCTGTGCTGTGTTGTGG + Intergenic
1190436443 X:50430367-50430389 ACCCTGCCTGCAGTGTGCTGTGG - Intronic
1191019260 X:55842266-55842288 GTAGTGGCTGTGCTGTGCTGGGG + Intergenic
1191019305 X:55842532-55842554 AGGGTGGCTGCACTGTGCTGGGG + Intergenic
1191156932 X:57283989-57284011 AAGGTGACTGCGCTGTGCTGTGG + Intergenic
1191657468 X:63613877-63613899 ACAGTGGCTTTACCGAGCTGCGG - Intergenic
1191877313 X:65809781-65809803 AGAGCTGCTGCACTGTGCTGGGG - Intergenic
1192319019 X:70074255-70074277 GCAGAGGTTGCAGTGTGCTGAGG - Intergenic
1192935076 X:75850605-75850627 ACAGTGGCTGCTCAGGGCAGAGG + Intergenic
1193164286 X:78263879-78263901 GGAGGGGGTGCACTGTGCTGGGG + Intergenic
1193295897 X:79830584-79830606 AGAGTAGCTGTGCTGTGCTGGGG + Intergenic
1193425659 X:81338007-81338029 AAGGCAGCTGCACTGTGCTGGGG + Intergenic
1193494721 X:82197141-82197163 GCAATGGCAGCACAGTGCTGAGG + Intergenic
1193533593 X:82686353-82686375 GGAGGGGTTGCACTGTGCTGTGG + Intergenic
1193687171 X:84591804-84591826 ACAGTCACTGTCCTGTGCTGTGG - Intergenic
1194092391 X:89593822-89593844 ACAGTGGCTGCAGTAAGCTATGG + Intergenic
1194242621 X:91470421-91470443 ACAGTGGTTGAGCTCTGCTGAGG + Intergenic
1194635708 X:96343027-96343049 AGAGTAGCTGTGCTGTGCTGTGG + Intergenic
1195083919 X:101396741-101396763 GCAGAGGCTGCAGTGAGCTGAGG - Intronic
1195208266 X:102625501-102625523 GGAGTAGCTGCACTGTGCTGAGG + Intergenic
1195213101 X:102669586-102669608 ACAGCCGCTGTGCTGTGCTGTGG + Intergenic
1196167950 X:112555751-112555773 ACAGCTGCTGTACTGTGCTGTGG - Intergenic
1196234402 X:113261887-113261909 GGGATGGCTGCACTGTGCTGGGG + Intergenic
1196555860 X:117083913-117083935 ACAGTTGATGTGCTGTGCTGTGG + Intergenic
1197122284 X:122906607-122906629 ACAGCAGCTGTGCTGTGCTGGGG - Intergenic
1197628381 X:128829703-128829725 TCAGTGGCTGCACTGAGGTGTGG - Intergenic
1198648707 X:138837725-138837747 AGAGCCGCTGCACTGTGCTGGGG + Intronic
1199469797 X:148181773-148181795 ACAGTGGCTTTGCTGAGCTGTGG + Intergenic
1199478763 X:148274381-148274403 AGAGCAGCTGCACTATGCTGGGG - Intergenic
1199564401 X:149199204-149199226 AGAGGGGGAGCACTGTGCTGGGG + Intergenic
1200091907 X:153639991-153640013 ACGGGAGCTGCACTTTGCTGGGG - Intergenic
1200103425 X:153699788-153699810 AGGGTGGAAGCACTGTGCTGCGG + Intergenic
1200445023 Y:3249863-3249885 ACAGTGGCTGCAGTAAGCTATGG + Intergenic
1200803333 Y:7407078-7407100 ACAGTGGCTTTGCTGAGCTGCGG - Intergenic
1200977938 Y:9232446-9232468 ACAGAGGTTGCAGTGAGCTGAGG + Intergenic