ID: 1092995686

View in Genome Browser
Species Human (GRCh38)
Location 12:13948287-13948309
Sequence GCATTTAAACATATGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092995686_1092995691 -8 Left 1092995686 12:13948287-13948309 CCCTGCCCCATATGTTTAAATGC 0: 1
1: 0
2: 1
3: 8
4: 158
Right 1092995691 12:13948302-13948324 TTAAATGCTAAATTCAAAAATGG 0: 1
1: 0
2: 3
3: 71
4: 671
1092995686_1092995692 -7 Left 1092995686 12:13948287-13948309 CCCTGCCCCATATGTTTAAATGC 0: 1
1: 0
2: 1
3: 8
4: 158
Right 1092995692 12:13948303-13948325 TAAATGCTAAATTCAAAAATGGG 0: 1
1: 0
2: 4
3: 79
4: 668

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092995686 Original CRISPR GCATTTAAACATATGGGGCA GGG (reversed) Intronic
900110484 1:1003418-1003440 GCATTTCAAGATATGGGGATGGG - Intergenic
902590563 1:17471326-17471348 CCATTTAAAAAAATGGGGCTGGG + Intergenic
905978459 1:42199365-42199387 GAACTTAGCCATATGGGGCATGG - Intronic
908067467 1:60422830-60422852 ACATTTAAAAATCTGGGGTATGG - Intergenic
908477069 1:64499875-64499897 GCATTTAAACATATGATTCTGGG + Intronic
910352155 1:86309950-86309972 GCATTTAAAAATATGGGCAGAGG + Intergenic
911947659 1:104133071-104133093 ACATTTAATCTTAAGGGGCATGG + Intergenic
913145975 1:115990362-115990384 GCAATGAAAAACATGGGGCAAGG - Intronic
913688947 1:121260174-121260196 GCATTTTAAAATAAGGGGTAGGG + Intronic
914148653 1:145020103-145020125 GCATTTTAAAATAAGGGGTAGGG - Intronic
915314225 1:155018831-155018853 GGATCTGAACAGATGGGGCAGGG - Intronic
915822067 1:159034776-159034798 GCATTTAAACAATTGGGGTGTGG + Intronic
920476271 1:206278668-206278690 GCATTTTAAAATAAGGGGTAGGG + Intronic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
921916608 1:220619177-220619199 GCATTTAAAAATGTAGGGCTGGG + Intronic
1068808112 10:61223604-61223626 GCATTTAAAACTATGGCACAGGG + Intergenic
1069281941 10:66665613-66665635 GCATTGAAACAGATGGGTCGGGG - Intronic
1072307930 10:94125539-94125561 GCATTTAAAAATAAGGCGCTAGG - Intronic
1072583574 10:96761655-96761677 AGATTTATACATATGGAGCAGGG - Intergenic
1072657895 10:97343350-97343372 GGATTTAAAAATGTGGGGCTGGG + Intergenic
1073721262 10:106175166-106175188 GAATTTAAAAATTTGGGGCCAGG + Intergenic
1074229482 10:111519524-111519546 GCATTTACTCCTATGGGGAAGGG + Intergenic
1076263466 10:129090706-129090728 GCATTTAACCATTTGCTGCAGGG + Intergenic
1081012418 11:37831812-37831834 ACATTTAAAGATATGGAGCCTGG + Intergenic
1086538494 11:87879354-87879376 ACTTTTCAACATGTGGGGCATGG + Intergenic
1088680382 11:112236501-112236523 GCATTAAAAAAAATGTGGCAGGG - Intronic
1089634333 11:119802720-119802742 TCATGTAAACATAAGGGGCTTGG + Intergenic
1092995686 12:13948287-13948309 GCATTTAAACATATGGGGCAGGG - Intronic
1093223017 12:16446617-16446639 GCATTTAACCATCAGGGGCCTGG - Intronic
1094721444 12:33068696-33068718 ACACATAAACACATGGGGCAGGG + Intergenic
1096603651 12:52748536-52748558 GCATTTAAAAATAAGCAGCAGGG + Intergenic
1100013128 12:89977422-89977444 GCATTGAATTATCTGGGGCAGGG - Intergenic
1101900085 12:108785445-108785467 GCATGTAAACAGATGGCACATGG - Exonic
1103825135 12:123731973-123731995 GGATATACACATTTGGGGCATGG - Intronic
1105061663 12:133157885-133157907 GCATTTGAACATATCAGGGAGGG + Exonic
1105563023 13:21513413-21513435 TCATTAAAACAAATAGGGCAGGG - Intronic
1105835687 13:24209363-24209385 GCACTTAAAAGTATGGGGTAAGG + Intronic
1111502877 13:89146732-89146754 GTATTAAAACTTATGGGGTATGG - Intergenic
1117383999 14:55193116-55193138 GCATTTCACCATATTGGCCAGGG - Intergenic
1119440193 14:74623056-74623078 GCAGTTTAGCATATGGGGAAGGG + Intergenic
1120821394 14:88914887-88914909 GGGTTTAAAAATATGGGGCAGGG - Intergenic
1125143335 15:36436142-36436164 GCATTTAAACATTTGTGCCTCGG - Intergenic
1126238095 15:46409111-46409133 GGATTTCAACATATGGAGAAAGG - Intergenic
1128013431 15:64320381-64320403 CCATATAAAAATATGGGGCCGGG + Intronic
1130167593 15:81479510-81479532 GCATTAAGAGATATGGGGCCGGG + Intergenic
1132796449 16:1725977-1725999 TCATTAAAACATCTGGGGCCAGG - Intronic
1135693603 16:24566456-24566478 TCATTTAAACTTTTGGGGCCAGG + Intronic
1139208243 16:65050322-65050344 GGCTTTAAACAAATGTGGCATGG - Intronic
1140140531 16:72252420-72252442 TCATTTAGACATGTGGGGAAGGG + Intergenic
1143460267 17:7099343-7099365 AAATTTAAAAATATGGGGCCGGG + Intergenic
1146785852 17:35720730-35720752 CCATTTAAAAATATGGGGCAGGG - Intronic
1147225294 17:38971875-38971897 GCATTGAAAGCTCTGGGGCAAGG - Intergenic
1149766724 17:59284911-59284933 GAATTTAAACATTTGAGGCTGGG - Intergenic
1150611647 17:66738358-66738380 GCCTTTAAACATTTGGACCATGG + Intronic
1151055296 17:71023716-71023738 GTATTAAAATTTATGGGGCAGGG + Intergenic
1153409360 18:4776522-4776544 GGATTTCAACATATGGGTCTTGG + Intergenic
1155099755 18:22598892-22598914 GCATTTAGAATTTTGGGGCAGGG - Intergenic
1155331308 18:24721104-24721126 GCATTTCAACATATGTGTGATGG - Intergenic
1161494492 19:4580108-4580130 GCAATTTTACAAATGGGGCAGGG + Intergenic
1162898401 19:13779112-13779134 GCATTAGAACTTGTGGGGCATGG - Intergenic
1163315256 19:16536719-16536741 GCATCTAAACACATTGGGCTGGG + Intronic
1164010531 19:21199757-21199779 GGATTTGAACATATGCAGCATGG + Intergenic
1164939189 19:32238782-32238804 GTATTTCAGCATGTGGGGCAGGG + Intergenic
1165338992 19:35197098-35197120 GAATTTCAACATATGAGGCCGGG + Intergenic
1166175880 19:41069293-41069315 GCATTACAACAAATGGGCCAGGG + Intergenic
926254920 2:11184931-11184953 GCATTTATATATAAAGGGCAAGG - Intronic
927627417 2:24736689-24736711 GCATTTTAACATTTGGGGCTGGG + Intronic
933768289 2:85726172-85726194 GAATTTATACAAATGGGGCCAGG + Intergenic
939617533 2:144377922-144377944 ACATTTAAAATTAAGGGGCAGGG - Intergenic
941298214 2:163767303-163767325 GAATTCAATCACATGGGGCAAGG - Intergenic
942506716 2:176649483-176649505 GCATACAAACATTTGAGGCAGGG + Intergenic
943810325 2:192179348-192179370 GCATGTAAGCATATTTGGCAGGG - Intronic
945143624 2:206714022-206714044 TGATTCAAACATATGTGGCAAGG + Intronic
948647023 2:239411748-239411770 GCAGTTCACCATCTGGGGCAAGG + Intergenic
1168996286 20:2135565-2135587 GCATTTTAAGATCTTGGGCAGGG + Intronic
1174074626 20:47924675-47924697 GCATTCAGACAAATGGGGGAGGG - Intergenic
1175430080 20:58895553-58895575 GCATTTTAACACTTTGGGCAGGG - Intronic
1176208721 20:63906189-63906211 TTATTTAAAAATATGGGGCCAGG + Intronic
1177811321 21:25927631-25927653 TCATTTAAACATGTGTGGCCAGG - Intronic
1180123170 21:45767660-45767682 CCATTTTAAGAAATGGGGCATGG + Intronic
949305797 3:2639306-2639328 GCATGTTAACAGGTGGGGCAGGG - Intronic
949519549 3:4837337-4837359 GAATTTAAATATATGGGGTGAGG - Intronic
951696874 3:25454106-25454128 GCATCCAAACATTTGGGGCACGG - Intronic
955416932 3:58701126-58701148 GCTTTTAGAAATATGGGGGAAGG - Intergenic
956426120 3:69137447-69137469 GCATTTAAATAAAAAGGGCATGG - Intergenic
959653608 3:108775923-108775945 TCATTTAAACCAATAGGGCATGG + Intergenic
963616178 3:147541269-147541291 ACACTTAAACATATGGATCAGGG - Intergenic
966899711 3:184471852-184471874 GAACAGAAACATATGGGGCAGGG - Intronic
967302762 3:188031932-188031954 GGACTTAGACAGATGGGGCAGGG - Intergenic
968344907 3:197994424-197994446 CCATTTAAAAAAATGGGCCAAGG + Intronic
970163696 4:13214603-13214625 CCATTTTAAAATATGGGTCATGG - Intergenic
970674711 4:18435801-18435823 GCATATAAAAATCTGGGGAAGGG + Intergenic
970756284 4:19430123-19430145 GCATTTTAAAATACGGTGCAAGG - Intergenic
970958640 4:21846327-21846349 GCATTTACACATATATGGCAAGG + Intronic
972035706 4:34516862-34516884 TCATTTAAACATTTGTGGCTGGG - Intergenic
973152517 4:46906122-46906144 GGATTGAAATATATGGGGCCGGG - Intronic
976012925 4:80513912-80513934 ATATTTAAACATATGGGTTAAGG - Intronic
978647091 4:110947708-110947730 TCATTTGAAAATATGGGGGAAGG + Intergenic
981355708 4:143786947-143786969 TCTTTTAAACACATGGGGAAAGG - Intergenic
981367243 4:143917602-143917624 TCTTTTAAACACATGGGGAAAGG - Intergenic
982250532 4:153401782-153401804 CCATTTGTTCATATGGGGCATGG + Intronic
985852096 5:2396542-2396564 GCATGTATACATGTGGGACATGG - Intergenic
987376679 5:17241912-17241934 GCATTTAATTAAATGGGGGAAGG + Intronic
987836764 5:23172311-23172333 GAATTTAGACATAAGGGGAATGG + Intergenic
988251648 5:28766132-28766154 GTATTTATACATATGGGAAAAGG - Intergenic
989798118 5:45500491-45500513 GCATGCAAACATATGGGTAAAGG + Intronic
990893266 5:60670941-60670963 GCATTTACACAATCGGGGCAGGG + Intronic
990893675 5:60674564-60674586 GCAATCACACATATGGGGGATGG - Intronic
995921297 5:117317169-117317191 GCATTTAAAAAAATGGAGAAAGG - Intergenic
996419624 5:123248051-123248073 ACATTTAAACAGATGAGGAAAGG + Intergenic
997270889 5:132536949-132536971 GCACTTAAACATTAGAGGCAAGG + Intergenic
997485555 5:134227296-134227318 ACATTTAACCATAAAGGGCAAGG + Intergenic
998874361 5:146584247-146584269 GCAGTTTAACCAATGGGGCATGG + Intronic
999057310 5:148592329-148592351 ATAGGTAAACATATGGGGCATGG - Intronic
1000507471 5:162139278-162139300 GCATTTAAACCTTTTGGGCTTGG + Intronic
1000790390 5:165599701-165599723 GCATTTCACCATATTGGCCAAGG + Intergenic
1001756486 5:174174190-174174212 GCATTTAAAAATATGGAGTGTGG + Intronic
1002690874 5:181049807-181049829 GCATTTAATCATGTTAGGCAAGG - Intronic
1003451276 6:6235112-6235134 TCATTTTTACATATGGTGCAAGG - Intronic
1004227066 6:13795418-13795440 GCATATAAACTTCTGGGGCATGG - Intronic
1005882199 6:30070350-30070372 CCATTTATACTTATGGGGAAGGG + Exonic
1008117318 6:47567109-47567131 GCTGTTTAACATATGGGGTATGG + Intronic
1011010666 6:82700347-82700369 TCATTTAAACTTATAGGTCATGG - Intergenic
1012211210 6:96521178-96521200 GAATATAAACATAAGGTGCATGG - Intergenic
1017518383 6:155179113-155179135 GCATATATTCATATGGTGCAGGG - Exonic
1017700765 6:157067928-157067950 GGTCTTAAACATATGGGGTATGG - Intronic
1020695316 7:11406707-11406729 GATTTTAAAAATATAGGGCATGG + Intronic
1023119242 7:36892765-36892787 GCATTTAAGCAGGTGGGCCAGGG - Intronic
1023528485 7:41129791-41129813 GCATTCCAACACATGGTGCAGGG + Intergenic
1026425454 7:70288032-70288054 GCCTCTAAAGATATGAGGCATGG + Intronic
1028092115 7:86715844-86715866 GCATTTAAACATAAAAGGCCTGG + Intronic
1029427812 7:100507825-100507847 GCATTTTAAATTAAGGGGCAGGG - Intergenic
1032760543 7:134937108-134937130 GTAATTAAACACATGGGGGAAGG + Intronic
1035942189 8:3913641-3913663 GCATTGAGACATTTGGGTCAGGG + Intronic
1036571570 8:9984495-9984517 GCATTTTGACATGTGGGTCAGGG - Intergenic
1037271221 8:17132522-17132544 GCCTTTATACATTAGGGGCAAGG - Intergenic
1038050569 8:23806516-23806538 ATATTTAAACATATGGTACATGG + Intergenic
1040518543 8:48154463-48154485 TCATTTAAATATATGGTGCTGGG - Intergenic
1040683180 8:49838190-49838212 GCTTTTAGACAGATGGGGGAGGG + Intergenic
1042312404 8:67392065-67392087 GCAATTGATCATATGGGGAAGGG + Intergenic
1042657925 8:71120713-71120735 GCATTTAAACATATAGATCAAGG + Intergenic
1046553637 8:115748783-115748805 GAATTAAAATATATGGTGCAGGG + Intronic
1047182005 8:122597506-122597528 TTATTTAAAAATATGGGGCTGGG + Intergenic
1047326328 8:123839836-123839858 GCATGTTAACATATGGAGTATGG + Intergenic
1047632783 8:126726412-126726434 GCACTTAAGCATAAGAGGCAAGG + Intergenic
1047812102 8:128422100-128422122 GCATTTAAACTGATGGTGGAAGG + Intergenic
1051302419 9:15665979-15666001 TCATTTAAACATATTGAGAAAGG + Intronic
1051562311 9:18455699-18455721 GTTTTTAAACATTTTGGGCATGG + Intergenic
1054969494 9:71068819-71068841 GCTTGTGAACATATGGGGAAGGG + Intronic
1055554207 9:77459302-77459324 ACAATTAAACATAAGGAGCAGGG + Intronic
1055935578 9:81601442-81601464 GCATTAAAACATAGGGTGAAAGG + Intronic
1056985788 9:91362634-91362656 GCATTTAAGAATACTGGGCAGGG + Intergenic
1061270866 9:129541282-129541304 GCAAGAAAACATAAGGGGCAGGG - Intergenic
1187190819 X:17033285-17033307 GGATTGAAACAAATGAGGCAGGG - Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1190403054 X:50058179-50058201 GCATTCAAAGAAATGGGGCAGGG - Intronic
1193928307 X:87518619-87518641 GCATTTAAACATCTGAGCCACGG - Intronic
1194969937 X:100332224-100332246 GCTTTTAAAACTATGGGGCCAGG + Intronic
1195030429 X:100922368-100922390 TAATTTAAACATTTTGGGCAAGG + Intronic
1195735405 X:108007825-108007847 GTATTTAAACCTATTGGGAAAGG + Intergenic
1196064117 X:111443885-111443907 GCCTTTAAATATATGTGGTATGG - Intergenic
1196305972 X:114103818-114103840 GCATTTAGGCAGATGGGGGAGGG - Intergenic
1198153076 X:133930362-133930384 ACATTTGAACATTTGGGACAAGG - Intronic
1199406728 X:147470924-147470946 CCATTTAAACGTATGGAGAATGG - Intergenic
1202170407 Y:22037539-22037561 GCCTTTAAACAAATGGTGCCAGG + Intergenic
1202220957 Y:22548834-22548856 GCCTTTAAACAAATGGTGCCAGG - Intergenic
1202322155 Y:23646829-23646851 GCCTTTAAACAAATGGTGCCAGG + Intergenic
1202548613 Y:26023227-26023249 GCCTTTAAACAAATGGTGCCAGG - Intergenic