ID: 1092998829

View in Genome Browser
Species Human (GRCh38)
Location 12:13976910-13976932
Sequence GTGGGCAAATGGACTGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 242}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092998829_1092998841 15 Left 1092998829 12:13976910-13976932 CCAATTTCAGTCCATTTGCCCAC 0: 1
1: 0
2: 0
3: 17
4: 242
Right 1092998841 12:13976948-13976970 TGCCTCTCCCCACACAAGACTGG 0: 1
1: 0
2: 1
3: 12
4: 220
1092998829_1092998842 16 Left 1092998829 12:13976910-13976932 CCAATTTCAGTCCATTTGCCCAC 0: 1
1: 0
2: 0
3: 17
4: 242
Right 1092998842 12:13976949-13976971 GCCTCTCCCCACACAAGACTGGG 0: 1
1: 0
2: 1
3: 17
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092998829 Original CRISPR GTGGGCAAATGGACTGAAAT TGG (reversed) Intronic
900140215 1:1136714-1136736 GTGGGCAAATGAAGTGAGACCGG - Intergenic
904000039 1:27333741-27333763 GGGGGGATATGGAATGAAATTGG - Intronic
906091255 1:43181298-43181320 GTGGGCAGATGACTTGAAATGGG - Intronic
911420631 1:97636290-97636312 GTGGGAAAAAGGGATGAAATAGG - Intronic
913156059 1:116099628-116099650 GTAGGCAAAAGAACTGAAACCGG + Intergenic
913344295 1:117792830-117792852 GTGTGAAAATGGACTGATACAGG - Intergenic
916346355 1:163796089-163796111 AGGTGGAAATGGACTGAAATGGG + Intergenic
917477475 1:175381236-175381258 CTGGGCAAAGGGACTGGACTGGG + Intronic
920805217 1:209227317-209227339 GTGGTGAAATGAAATGAAATTGG - Intergenic
921076273 1:211702619-211702641 GTGGTGAAAGGGACTGAAATAGG + Intergenic
921678672 1:218006257-218006279 GTGGGCAAAGGGAGTGAGAAAGG - Intergenic
922789822 1:228305400-228305422 GTGGCCACATGGACTGATGTGGG + Intronic
922935108 1:229416577-229416599 GTGGTCACATGGGCTGAAAGAGG + Intergenic
923213899 1:231831710-231831732 GTGGTCACATGGGCTGAAAGAGG - Intronic
923334873 1:232959426-232959448 GTGTGAAAATGGACTAATATAGG + Intronic
1063657435 10:8006099-8006121 GTGGGCAGATGACCTGAAGTCGG + Intronic
1068197292 10:53733164-53733186 GTGGGCAGATGGCCTGATCTCGG - Intergenic
1072440516 10:95450123-95450145 GTGGGCAAATGCAAAGACATTGG + Intronic
1073266053 10:102229173-102229195 GTGGGCAAAGAGGATGAAATAGG - Exonic
1073716737 10:106115746-106115768 ATGAGCAAATTGACAGAAATGGG + Intergenic
1074222044 10:111447597-111447619 GTATGAAAATGGACTGATATAGG - Intergenic
1074663967 10:115696700-115696722 GTGTGAAAATGGACTGATACAGG - Intronic
1077460244 11:2705484-2705506 GTGGGAAAATGAAGTGAACTGGG + Intronic
1081269505 11:41066066-41066088 ATGGACAAATTGACAGAAATAGG + Intronic
1081367053 11:42248344-42248366 CTAGGCAAATGGATTAAAATCGG - Intergenic
1083144321 11:60747382-60747404 GTGTGCACATGGAGTGATATTGG - Intergenic
1084585662 11:70060499-70060521 GTGAGAAACTGGGCTGAAATTGG + Intergenic
1085034219 11:73290609-73290631 GTGGGCAAAGGCACAGAAGTGGG - Intronic
1086376691 11:86207955-86207977 GTGGGCAAATCACCTGAGATTGG + Intergenic
1087524441 11:99292015-99292037 GTAAGCAAATGGACCGAAAGTGG - Intronic
1087941817 11:104106835-104106857 GTGGGCAAATTGCTTGAACTCGG - Intronic
1088852514 11:113716447-113716469 TTGGGCTAATGAACTGAAAGTGG - Intergenic
1089953662 11:122551531-122551553 GTGGTCACATGGGCTGAAAGAGG + Intergenic
1090614001 11:128497967-128497989 TTGGGCAAATGGCCTAAAATAGG + Intronic
1091315550 11:134611576-134611598 GTGGGCACGGGGACTGAACTGGG - Intergenic
1092804102 12:12203282-12203304 CTGGCCAAATGGACTGACTTTGG - Exonic
1092998829 12:13976910-13976932 GTGGGCAAATGGACTGAAATTGG - Intronic
1093358781 12:18199527-18199549 GTGGTCACATGGGCTGAAAGAGG + Intronic
1096108862 12:49016988-49017010 GTGAGCAAGGGCACTGAAATTGG - Intronic
1098010066 12:66041376-66041398 GTGTGCAAATTGACTTAATTAGG - Intergenic
1098192553 12:67965903-67965925 GTGTGCCATTGGTCTGAAATAGG + Intergenic
1098772993 12:74578324-74578346 GAGAGTAAATGGCCTGAAATAGG - Intergenic
1100604873 12:96143376-96143398 GTGGGCATGGTGACTGAAATGGG + Intergenic
1100927771 12:99569313-99569335 CTGGGGAACTGGACAGAAATTGG + Intronic
1101208476 12:102512852-102512874 GTGGGCAAAGGTAGTGGAATTGG + Intergenic
1103789699 12:123460884-123460906 GTGGGCAGATTGCCTGAAGTCGG - Intronic
1106382901 13:29257156-29257178 GTGGGAAAATGGATTTGAATAGG - Intronic
1107436418 13:40384219-40384241 GTGTGCAAATGCACTGACTTAGG - Intergenic
1108843130 13:54645803-54645825 ATAAGCCAATGGACTGAAATAGG - Intergenic
1111576318 13:90158236-90158258 GTGGGAGAATGGCCTGAACTCGG - Intergenic
1112709045 13:102105418-102105440 GAAGGCAAATGGAATAAAATAGG - Intronic
1112924647 13:104659297-104659319 ATGGACAAATGGAGAGAAATTGG + Intergenic
1112975051 13:105307173-105307195 ATGGGCAAATGGACTTAAGTAGG - Intergenic
1114752955 14:25226186-25226208 GTGAGCAAATAGACTCAAAGAGG - Intergenic
1116216321 14:42021933-42021955 GTGGGCAAAAGGTAGGAAATTGG + Intergenic
1117154135 14:52920848-52920870 GTGGGAAGATGGACTGAACCTGG + Intronic
1118902583 14:69999198-69999220 GTGGCCAAATGGCCTGAAGCAGG - Intronic
1119899859 14:78250509-78250531 AGGAGCAAATGGAATGAAATTGG - Intronic
1120092437 14:80348408-80348430 GTGTGCAAATGGACTAATACAGG - Intronic
1120265050 14:82238010-82238032 ATTGGCAAATTGATTGAAATTGG + Intergenic
1124136172 15:27038107-27038129 GTGGCCAACCGGACTGAGATGGG - Intronic
1124820062 15:33035905-33035927 GTGGGTTAATGGACTGTCATAGG + Intronic
1125236336 15:37518401-37518423 GTGTGAAAATGGACTGATACAGG - Intergenic
1126475160 15:49058320-49058342 GAGGGCACATGGCCTGAAATGGG - Intergenic
1128809130 15:70557286-70557308 TTGGCCAAATGGACTGGAGTAGG - Intergenic
1129601377 15:77000562-77000584 GTGGGGAAATGGAGAAAAATAGG + Intronic
1131911793 15:97213397-97213419 GTGGGCAAATCACCTGAGATCGG - Intergenic
1134766041 16:16758938-16758960 GTGGGGAAATAGACTCTAATAGG - Intergenic
1134980006 16:18600276-18600298 GTGGGGAAATAGACTCTAATAGG + Intergenic
1136660550 16:31756744-31756766 GTGTTCAATTGGACTGAAAAAGG - Intronic
1137346108 16:47661678-47661700 GTGAGGAACTGGAATGAAATGGG - Intronic
1137521109 16:49196093-49196115 GATGGCAAATGGACTGCAAATGG + Intergenic
1138578163 16:57922084-57922106 GTGGGCAACTGGACTGAGGGTGG + Intronic
1140556976 16:75932589-75932611 GGGGTTCAATGGACTGAAATGGG + Intergenic
1140721834 16:77779137-77779159 GTGGGAAAATCGCCTGAACTCGG + Intergenic
1141016384 16:80454459-80454481 AAGGACAAATGAACTGAAATAGG + Intergenic
1141705061 16:85660227-85660249 GTGGGAAAATCGACCGAAACTGG + Intronic
1142378401 16:89718423-89718445 GTGTGCAAAGGCCCTGAAATAGG - Intronic
1145374586 17:22335631-22335653 GTGGGGAAATGGAGGGATATGGG + Intergenic
1145857703 17:28178212-28178234 ATGGACACATGGTCTGAAATAGG - Intronic
1146335817 17:31969375-31969397 GTGGGCAAATCACCTGAGATCGG - Intronic
1147312025 17:39601101-39601123 ATGGGCAAATGGCCTGGACTCGG + Intergenic
1147457317 17:40545945-40545967 GTGGGCGCATGGACGGAAAGGGG - Intergenic
1147617561 17:41838780-41838802 GTGGGAGAATGGATTGAACTGGG - Intronic
1149943129 17:60892535-60892557 GCGGGCAGATGACCTGAAATTGG - Intronic
1150378070 17:64698632-64698654 GTGGAGAAAGGGAGTGAAATAGG - Intergenic
1150488307 17:65559184-65559206 GTGGGGAAATATACCGAAATTGG - Intronic
1151767785 17:76141007-76141029 GTGGGCCCAGGGACTGACATCGG - Intronic
1155319082 18:24601192-24601214 GTGGCCAAATGTACTGAGATTGG - Intergenic
1155566990 18:27146365-27146387 TTGGGTTAATGGACTGAGATGGG - Intronic
1156199803 18:34817957-34817979 GTGGGGAAATGAAATGAAATGGG - Intronic
1156411339 18:36830421-36830443 GTGGACAACTGGGCTGAATTAGG + Intronic
1158349677 18:56552296-56552318 GTAGCCAAATTGACTGACATTGG + Intergenic
1158430360 18:57379843-57379865 GTGGGAGAATTGACTGAAAGGGG - Intergenic
1159067742 18:63588761-63588783 GTGGGCATCTTGACTGCAATTGG + Exonic
1159761778 18:72435460-72435482 GAGGGCAAATGTACTGATATAGG - Intergenic
1159892627 18:73966832-73966854 GTGTGAAAATGGACTAATATAGG + Intergenic
1160030286 18:75250909-75250931 GAGGGCACAGGCACTGAAATAGG - Intronic
1165610575 19:37148502-37148524 GTGGGAAAAGGGACTAAAAAGGG + Exonic
925494954 2:4436368-4436390 GTGGGAAAATGGACTAATACAGG - Intergenic
926994390 2:18718192-18718214 GTGGTCAAATGCATAGAAATGGG - Intergenic
927208697 2:20625673-20625695 GTCGGCAAGTGCACTGTAATGGG - Intronic
927255679 2:21038685-21038707 ATGGGCAAAGAGACTGATATGGG - Intronic
927318868 2:21719797-21719819 GTGGGCAAAAGGACTGAATAGGG - Intergenic
929509898 2:42558476-42558498 GTGGGCAGATGGCCTGAGGTCGG - Intronic
930808699 2:55518995-55519017 CTGGGCCAATGGTCTGAAAATGG + Intergenic
931173575 2:59830500-59830522 GAGGGAAAATGGTCTGAACTTGG - Intergenic
936277258 2:111110556-111110578 ATGGCCAGATGGACTGGAATTGG - Intronic
936629526 2:114186688-114186710 GTGTGAAAATGGACTAACATAGG + Intergenic
937792895 2:125981277-125981299 GTGGGCAACTGTACATAAATAGG - Intergenic
939026948 2:137025365-137025387 CTGGGACAATGCACTGAAATAGG - Intronic
941007615 2:160263610-160263632 GTGGGCACATGGAGACAAATGGG + Intronic
942785153 2:179692506-179692528 TTGGGCAAATCAACTGACATGGG - Intronic
943945938 2:194064619-194064641 GTGTGAAAATGGACTAATATAGG - Intergenic
944428810 2:199611493-199611515 GAGGTCAAAAGGACAGAAATGGG - Intergenic
944702700 2:202260062-202260084 GTTGGGAGATGGACAGAAATAGG - Intergenic
945415085 2:209560710-209560732 GTGGGCAAATGGATTGTTGTGGG + Intronic
946460401 2:219863639-219863661 TTGGGCAGATGGACGAAAATAGG - Intergenic
1169744881 20:8933571-8933593 GTTGGCAAGTGGGCTGTAATGGG - Intronic
1169768623 20:9176952-9176974 GTGGGCAAAGGGAGTGCAAATGG + Intronic
1170803678 20:19611491-19611513 CTGGACAAATGGATGGAAATGGG + Intronic
1171378163 20:24709394-24709416 GCTGGCAAATAGAGTGAAATTGG - Intergenic
1171931388 20:31232271-31232293 GTGGTGAAATGGATTGGAATGGG + Intergenic
1172018518 20:31895769-31895791 GAAGGCAGAGGGACTGAAATGGG - Intronic
1172316712 20:33961061-33961083 GTGGGCAGATGGCCTGAGCTCGG + Intergenic
1172598854 20:36169646-36169668 GTGGGCAAATGCCCAGAGATGGG - Intronic
1173400774 20:42723874-42723896 GTAGGCAACTGGACTGGAGTGGG + Intronic
1174023394 20:47550214-47550236 GTGGGCAAATGACCTGAGGTTGG + Intronic
1174815409 20:53682989-53683011 GTGGGCAAATTGATTGAGCTCGG + Intergenic
1175147821 20:56910169-56910191 GTGGGGAAGGGGACAGAAATAGG - Intergenic
1175213567 20:57377251-57377273 GTGGGCCAAAGGACTGGAAGAGG - Intronic
1177149081 21:17436595-17436617 CTGGGAAACTGGAATGAAATGGG - Intergenic
1177669332 21:24206152-24206174 GTGGGGAAATGGAGTAAAAACGG + Intergenic
1177765365 21:25451126-25451148 GTGTGAAAATGGACTAATATAGG - Intergenic
1182229818 22:28829143-28829165 GCGGGCAGATTGCCTGAAATTGG - Intergenic
1184348634 22:43928509-43928531 GTTGGCTCATGGACTGAAAGGGG - Intronic
1185144415 22:49123153-49123175 GGGGGCAAATGGAAGGAAAGTGG + Intergenic
950904817 3:16528600-16528622 TTGGAAAAATGGAGTGAAATAGG - Intergenic
952601295 3:35086522-35086544 TTAGGCATATGGACTGAACTTGG - Intergenic
952824878 3:37516381-37516403 GTGGACAAATGGCTTGAAATTGG + Intronic
953115513 3:39989004-39989026 ATGGACAAATTGACAGAAATAGG - Intronic
953499928 3:43423499-43423521 TGGGGCAAATGAACAGAAATGGG + Intronic
953699965 3:45187858-45187880 TTCAGCAAATGGACTGAAACTGG + Intergenic
954041663 3:47892337-47892359 GAGGGCAAACTGAATGAAATTGG - Intronic
954289406 3:49641880-49641902 ATGTGCAAATGGCCTGAAGTGGG + Intronic
954480601 3:50796564-50796586 GTGGGCAAATCACCTGAAGTTGG - Intronic
954495322 3:50953754-50953776 GTGGGCAAAGAGAGTGAATTTGG + Intronic
955551453 3:60089489-60089511 GTGGATAAATGGACGGAAAGAGG + Intronic
955603999 3:60679777-60679799 GTTGGCAAATGTAGTGGAATTGG - Intronic
956486845 3:69732006-69732028 GTGGGCAGATCGCCTGAACTCGG - Intergenic
957121494 3:76100458-76100480 GTTTGCAAATGGACAGAAATTGG - Intronic
958893052 3:99801638-99801660 GTGGGAAAATGGCATAAAATAGG + Intergenic
960150855 3:114247230-114247252 GTGCGAGAATGGACTGAGATGGG + Intergenic
961247999 3:125473506-125473528 GTGGGAAAATTGCCTGAACTAGG - Intronic
961483775 3:127202003-127202025 ATGGGAAAATGTACTAAAATAGG - Intergenic
962271899 3:133983588-133983610 GTGAGCAAAGGCACTGACATAGG - Intronic
963311517 3:143715166-143715188 GTGTGAAAATGGACTAATATAGG + Intronic
963634397 3:147776298-147776320 CTGGGCAAAAGGATAGAAATGGG + Intergenic
964388306 3:156172749-156172771 GTAGGCTAAAGGACTGAGATAGG + Intronic
966994675 3:185267981-185268003 GTGGGCAACTGGACTTATATTGG + Intronic
967948343 3:194821842-194821864 GTGGTCAAAGGGAAAGAAATTGG - Intergenic
968178946 3:196575903-196575925 GTGGGCAAATCGCCTGAACTCGG - Intronic
968926960 4:3554042-3554064 GTGAGCAAATGGAAAGAAAGAGG - Intergenic
969208423 4:5666405-5666427 GTGAGAAAAGGGACTGAATTAGG - Intronic
970187286 4:13470907-13470929 GGGGGCAAAGGGACTGAAGAGGG + Intronic
971610019 4:28711894-28711916 GTGGGCTATTGAACTGAAAGAGG + Intergenic
971972598 4:33639021-33639043 GTGGGAAAATGGACTAATACAGG + Intergenic
974181095 4:58385941-58385963 ATGGGCAAATTGACAGAAGTAGG - Intergenic
975324052 4:73040237-73040259 GTGGGCAAATCGCCTGAGGTCGG - Intergenic
976565242 4:86545613-86545635 GTGGGCAAATGGTGGGACATCGG + Intronic
977030642 4:91877639-91877661 GTGTGAAAATGGACTGATACAGG + Intergenic
978843931 4:113249475-113249497 GAGGGTCAATGGAATGAAATTGG - Intronic
980794109 4:137658853-137658875 GTGGGCAGATCAACTGAAGTCGG + Intergenic
980864974 4:138543360-138543382 ATGGGCAAATTGACAGAAGTAGG + Intergenic
981584423 4:146285829-146285851 GTGGTGAAAAGGACTGAATTTGG + Intronic
983089391 4:163486214-163486236 GTGTGAAAATGGACTAATATAGG - Intergenic
985074775 4:186203576-186203598 GTTGGCAGATGAAATGAAATCGG + Intronic
985246419 4:187983874-187983896 GGGAGTAAATGGACTGAAAATGG + Intergenic
987185773 5:15417463-15417485 TTGGGCAAGTGGGCTAAAATTGG - Intergenic
987341981 5:16947355-16947377 GTGTGAAAATGGACTAATATAGG + Intergenic
989712599 5:44418028-44418050 GTGGGCAAATGGTCTGGGGTGGG - Intergenic
990204583 5:53414994-53415016 GTGGGCAAATGGAAGAAGATGGG + Intergenic
990480943 5:56210099-56210121 GTGGGAAAATAGCTTGAAATCGG - Intronic
992225323 5:74614736-74614758 GGGGGCACCAGGACTGAAATTGG + Intergenic
993495067 5:88599681-88599703 GTCTGCAAATGAACTGAACTGGG - Intergenic
994673256 5:102788045-102788067 GAGTGCAAGTGAACTGAAATAGG - Intronic
995434788 5:112123478-112123500 GAGGGCAAATGAAGGGAAATGGG - Intergenic
999100291 5:149018344-149018366 GTGGGAAAATGGACTAATATAGG - Intronic
999571400 5:152924090-152924112 GTGGTCAAATAGAGTGAAATAGG - Intergenic
1000146042 5:158454388-158454410 TAGGGGAAATGGACTGAAAGAGG + Intergenic
1000233718 5:159338315-159338337 GTGGGCAACTGGAAGGAAGTGGG + Intergenic
1001913275 5:175538835-175538857 GAGAGAAAATGGTCTGAAATAGG - Intergenic
1003064097 6:2888192-2888214 GTGAGGAAGTGGACAGAAATTGG + Exonic
1003443087 6:6161278-6161300 GTGGGCCACTGGCCTGAAGTGGG - Intronic
1004026966 6:11828229-11828251 GTGGGAAAAGGGACAGAGATGGG - Intergenic
1004326778 6:14682259-14682281 GTAGGCAAATCCACAGAAATGGG + Intergenic
1005108778 6:22254467-22254489 GGGGGCAAAGGGATAGAAATGGG - Intergenic
1005227435 6:23658837-23658859 GGGTGCAAATGGATTGAATTGGG + Intergenic
1009585670 6:65598569-65598591 GTTGGCAAATGGAGTAAAAAAGG - Intronic
1011321229 6:86095417-86095439 GTGGACAAATTGACAGAAGTGGG + Intergenic
1011419100 6:87153210-87153232 GTGGGAAAATGATCTGCAATGGG - Intronic
1012675382 6:102106152-102106174 GTGGTCATATGGGCTGAAAGAGG + Intergenic
1013401217 6:109798240-109798262 GTGGTGAAATGGACAGAACTTGG + Intronic
1014077779 6:117256573-117256595 GTGTGGAAATGGACTAATATAGG + Intergenic
1015664551 6:135613663-135613685 GTGGCAAAATGGACTGATTTTGG - Intergenic
1022225782 7:28361495-28361517 GTGGGCATATGACCTGACATTGG + Intronic
1022688249 7:32617047-32617069 GTGGGCAAATAGAATGAATATGG - Intergenic
1027230230 7:76267972-76267994 GAGGGCAGAGGGACTGAGATGGG - Intronic
1027548996 7:79567572-79567594 GTTAGCAAAAGGATTGAAATGGG - Intergenic
1028126435 7:87118534-87118556 GTTGGCAGATGGACGGATATTGG - Intergenic
1028605098 7:92646624-92646646 GTGGGCAGATTACCTGAAATTGG - Intronic
1030375964 7:108754059-108754081 GTGGGACAATGGAATGAAAAGGG + Intergenic
1032474517 7:132203007-132203029 CTGAGCAGAGGGACTGAAATGGG + Intronic
1033413314 7:141139992-141140014 GTGGGCAGATGACCTGAAGTCGG - Intronic
1036727291 8:11231368-11231390 GTGGGAAAATGGTATGAGATAGG - Intergenic
1038387041 8:27158298-27158320 CTGGGCATTTGGACTGAAACAGG - Intergenic
1039754711 8:40511421-40511443 TTGAACAAATGGACAGAAATAGG - Intergenic
1040004936 8:42612048-42612070 GTGGGCAGATGACCTGAGATTGG - Intergenic
1040763227 8:50875209-50875231 ATGGACAAATGGACAGAAGTAGG + Intergenic
1040968681 8:53111469-53111491 TTGGACAAATTGACAGAAATAGG - Intergenic
1042650687 8:71037513-71037535 GTTGGGAAAAGGACTGGAATAGG - Intergenic
1043520958 8:81044782-81044804 GTGTTCAAATGCACTGACATAGG - Intronic
1046617128 8:116489983-116490005 GTGTGAAAATGGACTAATATAGG - Intergenic
1047213697 8:122859972-122859994 GTGTGAAAATGGACTGATACAGG - Intronic
1047469780 8:125158822-125158844 ATGGGGAAATAGACTGAACTGGG + Intronic
1048387604 8:133927121-133927143 GTGGGAAAATGGACTAAAACAGG + Intergenic
1048979704 8:139696783-139696805 GTGGGTAAATGGATATAAATGGG + Intronic
1049387995 8:142353933-142353955 GTGGGGAAGAGGACTGAATTTGG - Intronic
1052225156 9:26077118-26077140 GTGGACAAATTGACTGAAGTAGG - Intergenic
1052541193 9:29813201-29813223 GAGAGGAAATGGACAGAAATAGG + Intergenic
1054143385 9:61545876-61545898 GTGAGCAAATGGAAAGAAAGAGG + Intergenic
1054190257 9:61981104-61981126 GTGAGCAAATGGAAAGAAAGAGG - Intergenic
1055951206 9:81731322-81731344 GTGGGCAGATGACCTGAGATTGG + Intergenic
1056324178 9:85462850-85462872 GTGGTCATATGGGCTGAAAGAGG + Intergenic
1057043751 9:91867531-91867553 TTGGGCTAGAGGACTGAAATGGG + Intronic
1057195531 9:93114088-93114110 GTGGGCAAAGGGGCTGAGACTGG - Intergenic
1058957548 9:109963179-109963201 CTGAGCAAAGGGCCTGAAATAGG + Intronic
1059083540 9:111275325-111275347 GAGGTAAAATGGACAGAAATGGG - Intergenic
1059286100 9:113172928-113172950 CTGGGCAAAGGCACTGAGATAGG - Intronic
1060569920 9:124628886-124628908 GTGGGCAGATTGCCTGAACTCGG - Intronic
1060619401 9:125050165-125050187 TTGGGGAAATGGAATGAAGTGGG - Intronic
1186826166 X:13341947-13341969 GTGGGCAAGTGGAGTGATACCGG + Intergenic
1187956454 X:24523519-24523541 GTGGTGCAATGGACTGGAATGGG + Intronic
1188305556 X:28557108-28557130 GTGTGAAAATGGACTGACACAGG - Intergenic
1188472970 X:30560851-30560873 TTGGGAAAATAGGCTGAAATTGG + Intronic
1188976912 X:36686817-36686839 GTGGGAAAATGGAATGGAAAGGG - Intergenic
1190322391 X:49186655-49186677 GTGGCCAACTGGACTGAGAGGGG + Intergenic
1191079727 X:56496640-56496662 GTGGGCAGATCGACTGAGGTTGG - Intergenic
1192539813 X:71958276-71958298 GTGGCCAAATGGACTTAGCTGGG + Intergenic
1192905037 X:75542394-75542416 GTGTGAAAATTGACTGATATAGG - Intergenic
1193897787 X:87134649-87134671 GTGGGCGAATGACCTGAAGTTGG + Intergenic
1196208196 X:112965197-112965219 TGTGGAAAATGGACTGAAATGGG - Intergenic
1196406181 X:115365194-115365216 GTGGGAAAATGGACAGAACTTGG + Intergenic
1197302796 X:124802100-124802122 ATGGGCAAATTGACAGAAGTAGG - Intronic
1197740960 X:129893595-129893617 GTGGGCAGATTGCTTGAAATCGG - Intergenic
1198316448 X:135471514-135471536 GTGGGAAGAAGGACTGAAAGAGG - Intergenic
1198748421 X:139914221-139914243 CTGGGAAAATGGACTGAGAGAGG - Intronic
1199240635 X:145544227-145544249 GTGTGAAAATGGACTAATATAGG - Intergenic
1200204417 X:154305490-154305512 GTGGGAACAAGGCCTGAAATGGG + Intronic
1201131012 Y:10952027-10952049 GGAGTCAAATGGAGTGAAATGGG - Intergenic