ID: 1092999693

View in Genome Browser
Species Human (GRCh38)
Location 12:13982390-13982412
Sequence CTTGAAGGCAAGAAAGAACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 273}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092999693_1092999696 6 Left 1092999693 12:13982390-13982412 CCGGGTTCTTTCTTGCCTTCAAG 0: 1
1: 0
2: 2
3: 35
4: 273
Right 1092999696 12:13982419-13982441 AAGATCTATCTGAGCACACGAGG 0: 1
1: 0
2: 0
3: 2
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092999693 Original CRISPR CTTGAAGGCAAGAAAGAACC CGG (reversed) Intergenic
901342811 1:8510707-8510729 CTTGTAGGCAAGAAAGCATTTGG - Intronic
903252611 1:22067031-22067053 CCTGAAGGCAGGACAGAGCCTGG + Intronic
905471182 1:38193282-38193304 CAGGAAGGCAAAAAAGAACAAGG + Intergenic
905589528 1:39150580-39150602 CTTGGAGGAAACAAAGAACACGG - Intronic
906120624 1:43388094-43388116 ATTGAAAGCTAGAAAGAACTTGG + Intronic
906510437 1:46407627-46407649 GTTGAAGGCCAGAAACAGCCAGG + Intronic
906909150 1:49927394-49927416 CTGGAAGGCAAAGAAGAAGCAGG + Intronic
908457662 1:64320128-64320150 CTAGAGGGCAAGAAATAACTGGG + Intergenic
908910235 1:69064670-69064692 CTTTAAGGGAACAAAGAACCTGG - Intergenic
909045188 1:70701222-70701244 CATGAAGGCAAGAAAGTATTTGG - Intergenic
910321558 1:85950972-85950994 CATGAAGGCATGAAATGACCTGG - Intronic
912925369 1:113908109-113908131 CTTGTCGGGAAGGAAGAACCAGG - Exonic
913251128 1:116912539-116912561 CAGGAAGGAAAGAAAGAAGCTGG - Intronic
915060201 1:153175471-153175493 CTGGGAGGGAAGAACGAACCTGG - Intergenic
915529512 1:156495194-156495216 ATTGAAGGGAAGAGAAAACCAGG - Intronic
916365218 1:164018662-164018684 CTTGAAGGCCAAAAAGCACCAGG + Intergenic
917645809 1:177027614-177027636 CTTGAAGGGACAAAAGAACATGG - Intronic
918065590 1:181099075-181099097 CATAAAGGCAAAAAAGAACCAGG + Intergenic
918662622 1:187108039-187108061 CTTCAAGGACAGAAATAACCTGG - Intergenic
920112761 1:203598737-203598759 CTTGAAGGCAGGAAGGAACTTGG - Intergenic
920930662 1:210384719-210384741 CATGGAGGCAAGAAAGAAAATGG + Intronic
922418798 1:225445719-225445741 GTTGAAGGCAAGAGAGACACGGG + Intergenic
923195179 1:231659497-231659519 CTAGAAGACAAGAAATAACCAGG - Intronic
924033905 1:239916015-239916037 CTTTAGTGCAAGAAAGAACAAGG + Intergenic
1063195913 10:3742795-3742817 CTTGAAGGCAAAAAAATAGCAGG - Intergenic
1063413724 10:5856553-5856575 CCTGAAGGCAAGGGAGAGCCGGG + Intergenic
1064372168 10:14762108-14762130 GCAGAAGACAAGAAAGAACCTGG - Intronic
1065277163 10:24096851-24096873 CTAAAAGGCAAGAAAGAAGTGGG + Intronic
1065340689 10:24701950-24701972 CTTGAAGGAAACCAAGAACTGGG + Intronic
1065963883 10:30755108-30755130 CTTGAAGGGATGAAATAAACAGG - Intergenic
1067235511 10:44444644-44444666 AAAGAAGGAAAGAAAGAACCAGG + Intergenic
1067817978 10:49497254-49497276 CTTGGAGGATAGAAAGAAGCTGG - Intronic
1068091800 10:52441055-52441077 CCTGAAGGCAAGGGAGAGCCAGG + Intergenic
1069402332 10:68062440-68062462 CTTTAAAGCAAGAAAGGAGCAGG - Intronic
1070338911 10:75478978-75479000 AATGAAGCCAAGAAAGAAGCTGG - Intronic
1070626482 10:78054605-78054627 CTCGAAGGCAAGAGAAAGCCGGG + Exonic
1071246849 10:83774094-83774116 CTTGAAGGCAGGAGAGAAGCTGG - Intergenic
1071868985 10:89771023-89771045 TATGAAGGTAAGAAAGAAGCTGG - Intronic
1073120538 10:101119960-101119982 TTTGAAGGCCAAGAAGAACCAGG + Intronic
1074501826 10:114032426-114032448 CTTTGAGGCAAGATAAAACCAGG - Intergenic
1075787190 10:125057978-125058000 GTTGATGGCATGAAAGCACCAGG - Intronic
1076198891 10:128541873-128541895 TTTGAACACAAGAAAGAACCAGG + Intergenic
1076799705 10:132814917-132814939 GTTGAAGACAAGAAAGAGGCAGG + Intronic
1079308782 11:19346515-19346537 TTTGCAGGCAAGAAAGGAGCCGG - Intergenic
1084057525 11:66645843-66645865 CTTGAAGGCCAGAGAGTAACTGG - Intronic
1084967207 11:72751048-72751070 CTTGAATGCAAAACAAAACCTGG + Intronic
1088054420 11:105557900-105557922 GATGAAGGCATGAAAGAACATGG - Intergenic
1088076206 11:105851657-105851679 GTTAAAGGCAAGAGAGAATCTGG + Intronic
1089517707 11:119044403-119044425 CTCCAAGACAAGAATGAACCTGG - Exonic
1090007757 11:123017760-123017782 CTTGCAGGCATGAAAGGACTCGG + Intergenic
1090097545 11:123757747-123757769 CTGGGAGGCAAGAAAGAAGATGG - Intergenic
1090875403 11:130784582-130784604 CTTAAAGGTAAGAATGGACCAGG - Intergenic
1091193395 11:133712872-133712894 CTTAGAGGCATGAAGGAACCTGG + Intergenic
1092403372 12:8196905-8196927 GTGGAAGGCAAGACAGAAGCAGG + Intergenic
1092999693 12:13982390-13982412 CTTGAAGGCAAGAAAGAACCCGG - Intergenic
1093183392 12:15992454-15992476 TCTGGAGGCAAGGAAGAACCAGG + Intronic
1093256766 12:16877464-16877486 CTTGACAGCAAACAAGAACCTGG - Intergenic
1093465779 12:19447324-19447346 GGTGAGGGCAAGAAAGAACTCGG - Intronic
1094152076 12:27295916-27295938 CTTGGAGGCATGAAAGAGCTAGG + Intronic
1095106425 12:38238691-38238713 GTGGAAAGAAAGAAAGAACCAGG + Intergenic
1098237931 12:68435997-68436019 GTTGAAAGCTAGAGAGAACCTGG - Intergenic
1098807394 12:75036694-75036716 AATGCAGGCAAGAAAGAACGTGG + Intergenic
1099422458 12:82479465-82479487 CTTAAAGGGAAGAAATACCCAGG + Intergenic
1099607808 12:84827937-84827959 GTGGAAGGCAAAAAAGAAGCAGG - Intergenic
1100936741 12:99678359-99678381 CTTGGAGGCTAGAAAGAACCTGG + Intronic
1103572784 12:121856308-121856330 CGTGCAGGTAAGAAAGCACCTGG - Exonic
1104380080 12:128299769-128299791 CCTGGAGGAAAGGAAGAACCTGG - Intronic
1105049924 12:133039759-133039781 TTTGAAGGCAAGAAAGGAGGGGG + Intronic
1105932727 13:25067819-25067841 CTTGAAGGCAGGAACTACCCGGG + Intergenic
1106432000 13:29689453-29689475 CTTGAAGGGAAGAAACACCATGG - Intergenic
1106655360 13:31738570-31738592 CTAGAATGAAAGAAAGAACAAGG + Intergenic
1107297068 13:38920945-38920967 CTTGAAGGCAACAAACAGACGGG + Intergenic
1108738737 13:53312933-53312955 CTAGGAGGCAAGATAGAACATGG - Intergenic
1111649201 13:91068042-91068064 CTTGAAGGCTAGAAGGGACAAGG + Intergenic
1113145698 13:107204750-107204772 GTTTAAGGCAAAAAAGAAACGGG - Intronic
1114406769 14:22464087-22464109 CTTGCAGGCCAGAAAGAACTAGG + Intergenic
1115020515 14:28674561-28674583 CTAGAAGAGAAGGAAGAACCTGG - Intergenic
1115133575 14:30082631-30082653 GTTGAAGGGAAGAAACAAACAGG - Intronic
1116347918 14:43820092-43820114 GCTGAAGGGAAGAAAGAAACTGG + Intergenic
1116683587 14:48009791-48009813 CTTGAAGAGAAGACAGAACTGGG + Intergenic
1117398309 14:55334423-55334445 CTTGAAGACAGGGTAGAACCTGG + Intronic
1117838007 14:59827702-59827724 CTTGCAAGCAAGATAGAAACTGG - Intronic
1118032460 14:61832028-61832050 CGTGAAGCCAAGGAAGAACATGG + Intergenic
1118458780 14:65969096-65969118 CTTTAAGGCACGAAAGAACTTGG - Intronic
1120374480 14:83684988-83685010 TCTGAAGGCAAGGAAGAAACAGG + Intergenic
1122448429 14:101783982-101784004 CTTTTAGGGAAGAAAGACCCAGG + Intronic
1124044562 15:26136858-26136880 CTTTGAGGCAAGAAAAAACAGGG - Intergenic
1124908636 15:33896446-33896468 CATGAATGCAAGAAAGAACATGG - Intronic
1126052930 15:44703695-44703717 CTTGTAGGCAACAAATCACCGGG + Intronic
1127226180 15:56932005-56932027 TATGAAGGCAAGAGAGACCCTGG - Intronic
1127575062 15:60283746-60283768 CTTGAAGGAAAGAAAAGAACTGG + Intergenic
1127785014 15:62348143-62348165 CTAGATGGGAGGAAAGAACCCGG + Intergenic
1127978567 15:64017123-64017145 CTTGAAGGCAAGTAAGAAAAGGG - Intronic
1129199683 15:73991579-73991601 TTTGAGGGCAAGACAGAAGCAGG + Intronic
1130243681 15:82222371-82222393 CTTGAAGGAAAGACATAACCTGG - Intronic
1130456796 15:84118910-84118932 CTTGAAGGAAAGACATAACCTGG + Intergenic
1130660859 15:85830657-85830679 CTAGGAGGCAGGAAAGCACCAGG + Intergenic
1130916752 15:88311111-88311133 GCAGAAGGAAAGAAAGAACCTGG - Intergenic
1134907523 16:17993393-17993415 CTTGATGGGAAGAGAGAACCAGG - Intergenic
1135252204 16:20910165-20910187 CCCTAAGGCAAGAAAGAACATGG + Intronic
1135278185 16:21131341-21131363 CAAGAAAGCAAGAAAGAAACAGG + Intronic
1135502188 16:23006035-23006057 CCAGAAGGCAAGAAAGAGCTTGG + Intergenic
1135572259 16:23557943-23557965 CTTGCAGGCATGGAGGAACCTGG + Exonic
1137685462 16:50383657-50383679 CTGGAAGGGAAGAAAGCTCCTGG + Intergenic
1137997628 16:53236330-53236352 TATGAAGGCAAGCAAGAACTTGG - Intronic
1138178262 16:54923226-54923248 AATGAAGGCAACAAAGAACTGGG + Intergenic
1138596843 16:58033601-58033623 CTGGAAGTCAAGAAAGAAATTGG + Intronic
1139963326 16:70730416-70730438 CTTCAAGGCAAGAAGGAGCCTGG - Intronic
1140232340 16:73127603-73127625 CTGGCAGGCAAGAAAGGAACAGG + Intronic
1142809313 17:2387766-2387788 CTAGCAGGCAAGAAAGAGCCTGG + Intronic
1143375557 17:6464772-6464794 CTGGAAGGACAGAAAGAAGCTGG + Intronic
1144170895 17:12658903-12658925 CCTAAAGGCAAGAACGAAGCTGG + Intergenic
1145264563 17:21373583-21373605 CTGGAGGGGAAGAAAGAATCTGG + Intergenic
1146599038 17:34196774-34196796 CTTTCAGGAAAGAAAGAACAAGG + Intergenic
1148836397 17:50467992-50468014 CAGGAAGGGAAGAAGGAACCAGG + Intronic
1149376261 17:56047244-56047266 CTTTAAGGAAAGAAAGAAGCAGG - Intergenic
1149746628 17:59105668-59105690 CTGTAGGGCCAGAAAGAACCTGG + Intronic
1150476484 17:65479652-65479674 CTAGAGGGGAAGAAAGAACCAGG - Intergenic
1152329484 17:79663942-79663964 CTTGAAATCCAGAAAGGACCAGG + Intergenic
1154354815 18:13616702-13616724 CCTGCAGGCAACAAAGACCCAGG - Intronic
1155876958 18:31101045-31101067 CTTTAAAGAAAGAAAGAACCTGG + Intronic
1156948225 18:42861440-42861462 CTAAAAGGCAAGAAAGAAAAGGG - Intronic
1157397453 18:47354819-47354841 CAGCAAGGCAAGAGAGAACCAGG + Intergenic
1157951726 18:52045874-52045896 CTTGAAGGAAAGAAGGATCTGGG + Intergenic
1158233669 18:55287797-55287819 GATGAAGGGAAGAAAGAACAAGG - Intronic
1158664265 18:59418318-59418340 ATTGAAGGCCAGAAAGAATGGGG + Intergenic
1159847717 18:73485791-73485813 CTTTAAGGCAAGATTGAACCAGG + Intergenic
1159904903 18:74081020-74081042 CTTAAAGGCATGAAACAACATGG + Intronic
1160304320 18:77717701-77717723 CTTGGAAGCAAGAAAGATCGAGG - Intergenic
1160451240 18:78967343-78967365 GCTGATGGCAAGACAGAACCGGG + Intergenic
1162701931 19:12522720-12522742 CTTGAGAACAAGATAGAACCTGG + Intronic
1167344930 19:48939459-48939481 CTCGGAGGCAGGAAAGAAGCGGG - Exonic
1168132062 19:54327674-54327696 CTTGTATCCAAGAAAGAACATGG - Intergenic
925363848 2:3297554-3297576 CTAGAATGCAAGGGAGAACCTGG - Intronic
926247498 2:11131948-11131970 CTTGGATGCAAGAGAGAGCCTGG - Intergenic
927879990 2:26683612-26683634 CATGAAGGCAAGAAAAAGGCTGG + Intergenic
929157453 2:38800652-38800674 CTTGTAGGCAAGAAAGTTTCTGG + Intronic
929485612 2:42351360-42351382 CTTGAAAGCAAGAATTAACAAGG + Intronic
931124317 2:59256976-59256998 CTTGAAGGGAAGGGAGAACTAGG + Intergenic
931528700 2:63188013-63188035 CTTGAAGGCTAAAAAGAAATGGG - Intronic
931838909 2:66128412-66128434 CATGAAGGAAAGAAAGAAAAAGG - Intergenic
932135572 2:69225878-69225900 CTGAAAGGCAAGAAAGGACCAGG + Intronic
932408487 2:71530175-71530197 CTTGAAGGTAGGAAGGAAACAGG + Intronic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
933162558 2:79041896-79041918 CTGGAAAACAAGAAGGAACCAGG - Intergenic
934882538 2:97996092-97996114 CTTCACGGCCAGACAGAACCAGG + Intergenic
935060256 2:99601179-99601201 CTGGAAGTCAAGAGAGAATCTGG + Intronic
935206663 2:100902204-100902226 CTTGAAGGCAAACAAGGAACAGG - Intronic
935817913 2:106864426-106864448 CTTGAATGAAAGACAGAACATGG + Intronic
936390275 2:112066445-112066467 CTTGAATGGATGAATGAACCAGG - Intronic
936940291 2:117877926-117877948 CTTGAAGCCAGCACAGAACCAGG + Intergenic
937424840 2:121790200-121790222 ATTGGAGGAAAGAAAGAACAGGG + Intergenic
938316143 2:130330148-130330170 CTTGAGGGGAAGAAAGAAACTGG - Intergenic
940381743 2:153022815-153022837 ATTGAAGCCAGGAAAAAACCTGG - Intergenic
940516086 2:154685530-154685552 CTTGAAGGGAAGAGAGAATAAGG - Intergenic
940669861 2:156654081-156654103 CTGGAAGGCAAGAAAGAGGAAGG - Intergenic
940828130 2:158436601-158436623 GCAGAAGGCAAGAAATAACCAGG + Intronic
941560101 2:167034520-167034542 CTTGAAGGCAACAAATCACTGGG - Intronic
943170391 2:184390104-184390126 CTTCAAGGAAAGAAAAATCCAGG + Intergenic
944117863 2:196208642-196208664 CTTGGGGACAAGAAAGAGCCAGG + Intronic
945003456 2:205376847-205376869 CCTGAAGGAAAGAAAGTACATGG + Intronic
945047813 2:205797545-205797567 CTTGAATGCTAAAAAGAAGCAGG + Exonic
945208112 2:207353698-207353720 CTTGAAGGGCAGAAAGAATTGGG - Intergenic
945576510 2:211536643-211536665 CTTGAAATTAAGAAAGAAGCAGG + Intronic
947000606 2:225451226-225451248 CAGGAAGGCAAGAAACTACCAGG + Intronic
947035993 2:225856499-225856521 CATGAAGGCCAGAAAGAAGCAGG - Intergenic
948514477 2:238495160-238495182 CATGCAGGCAAAATAGAACCCGG - Intergenic
1168890187 20:1290355-1290377 CTGGAAGGGAAGAAGGAACAGGG - Intronic
1170106877 20:12761007-12761029 CTTAAAGGAAAAAAAAAACCAGG + Intergenic
1170814406 20:19700474-19700496 CTTGGATGCAAGAAGGATCCAGG + Intronic
1172392279 20:34573985-34574007 CTTGGAGGCAAGAATTACCCTGG + Intronic
1173126842 20:40345151-40345173 CTTGAAGCCAACACAGCACCAGG - Intergenic
1173481679 20:43405696-43405718 CTTGAAGGCAAGAAAAGATTGGG + Intergenic
1174960669 20:55153716-55153738 CTGGAATGCAAGAAAGAAGAAGG - Intergenic
1175579690 20:60088700-60088722 CTGGAAGGCAAGGAAGACCTAGG + Intergenic
1175661366 20:60815879-60815901 CCAGAAGGCAAGGAAGGACCAGG - Intergenic
1176912503 21:14583439-14583461 CTTGAAGGCAAGGAGAAACGGGG + Intergenic
1177340818 21:19797336-19797358 TTTCAAGGCAAGAGAGAACTGGG + Intergenic
1178034968 21:28570239-28570261 ATTGAAGGCAGCAAAGAAGCAGG + Intergenic
1178681100 21:34672405-34672427 TTTCAAGGCAGGAAAGAACGTGG - Intronic
1182785903 22:32907443-32907465 GTTGAATGCATGAAAGTACCTGG - Intronic
1184099698 22:42335679-42335701 CCTGAGGGCAAGAAAGAACTGGG + Intronic
951318476 3:21216038-21216060 CTTGAATGTAAGAAAGAAAATGG - Intergenic
953330938 3:42052597-42052619 CTTGAAGGAAAAAAATAACTTGG + Intronic
953715520 3:45313838-45313860 CTTGAAGGGAAGACAGACTCGGG + Intergenic
954491260 3:50908241-50908263 GTAGAAAGCAAGAAATAACCAGG - Intronic
954976398 3:54699238-54699260 CTAGCAGGCAAGAGAGAATCAGG + Intronic
957226286 3:77452064-77452086 AATGAAGGGAAGAAAGAAGCTGG - Intronic
958270897 3:91497943-91497965 CATGGAGGCATAAAAGAACCAGG + Intergenic
959454832 3:106546708-106546730 CTTGTAGGCAAGAAAGATTCAGG - Intergenic
959579272 3:107967492-107967514 CTAGAAGGCAAGAAACAAAATGG - Intergenic
959615308 3:108340840-108340862 TTTGAAAGAAAGAAAGAAACAGG + Intronic
960070282 3:113422645-113422667 TTTGAAGGAAAGAAAAAAACCGG - Intronic
961575536 3:127833066-127833088 CTGGAAGGCCACACAGAACCTGG - Intergenic
962330076 3:134470679-134470701 CTTTGAGGCAAGAAAGACCTAGG - Intergenic
963206225 3:142638349-142638371 GTTGAAGGCAAGAAAGGATAGGG + Intronic
963289655 3:143474810-143474832 CCTCAAGGCAAGAACAAACCTGG - Intronic
964409750 3:156385326-156385348 CTAGAAGGCACTAAACAACCAGG - Intronic
965403382 3:168240688-168240710 CTTGAAGGCAATAAGCATCCTGG - Intergenic
966595304 3:181720169-181720191 CAGGAAGGCCAGAAAGGACCGGG - Intergenic
966677294 3:182603082-182603104 CTTGAACACAAGAAAGCAGCAGG - Intergenic
967072042 3:185970963-185970985 TTTGAAGCCAAGAAGCAACCTGG - Intergenic
967358978 3:188608611-188608633 CTTGAAGCCAAGAACAAAGCCGG - Intronic
968006400 3:195246116-195246138 ATTACAGGCAAGAAAAAACCTGG - Intronic
969762695 4:9200955-9200977 GTGGAAGGCAAGACAGAAGCAGG - Intergenic
970006093 4:11412231-11412253 ATGGAAGTCAAGACAGAACCAGG - Intronic
971359548 4:25924024-25924046 CGTGGTGACAAGAAAGAACCAGG - Intronic
972893268 4:43586479-43586501 GTTGCAGGCAACAAAGAACCTGG - Intergenic
973077375 4:45946359-45946381 ACTGAAGGCAAGGAAGAACCTGG - Intergenic
975329479 4:73098587-73098609 CTTGAAGAAAAGAAAAACCCAGG + Intronic
975506789 4:75147243-75147265 CTTGCAGGGAAGAAGAAACCAGG - Intergenic
976098860 4:81539115-81539137 CTTGGAGGCAAGAAGGACCAGGG - Intronic
977706992 4:100082724-100082746 CCTGAAGGCAAGAGAAAACATGG + Intergenic
978667571 4:111203958-111203980 CCTGAAGGCATGCAAGACCCAGG - Intergenic
978721411 4:111914541-111914563 CATAAAGGCAAGAAATCACCTGG - Intergenic
980071155 4:128243820-128243842 CTAGAAGGAAAAAAATAACCTGG - Intergenic
980632861 4:135459853-135459875 CTTGAAGGTAAGAAAGCTCATGG + Intergenic
981403134 4:144337703-144337725 CTTGAGGGCTAGAGAGAACAAGG + Intergenic
982422654 4:155215007-155215029 ATTCAAGGCTAAAAAGAACCTGG + Exonic
982740661 4:159053870-159053892 CTTGAACCCAAGAATAAACCAGG + Intergenic
983255119 4:165390291-165390313 ACTGAAGGCAACACAGAACCAGG - Intronic
983507111 4:168565473-168565495 CCTGGAGGTAAGAAAGAACACGG + Intronic
984341087 4:178456944-178456966 TTTGAATGAGAGAAAGAACCGGG + Intergenic
984749693 4:183260218-183260240 ATTGAAAGCAAGAAAAAACAGGG - Intronic
984958463 4:185069819-185069841 GGTGAAGGCAAGAATGAACGAGG - Intergenic
986883215 5:12201366-12201388 CTTGGAGGAAAGAAAGAATCTGG - Intergenic
987119801 5:14756385-14756407 CTTGAAGGCAAGAAAACAGTAGG - Intronic
987749693 5:22023316-22023338 AATGAAGGCAAGAAATAACAGGG - Intronic
989427363 5:41312409-41312431 CTTGAAGGAAAGAAAGAGGAAGG - Exonic
990063766 5:51686168-51686190 CTTGAACACTAGAAATAACCAGG - Intergenic
992686621 5:79205608-79205630 GTGGAAGGAAAGAATGAACCAGG - Intronic
993124173 5:83811751-83811773 CGTGAAGGCAGGAAAGAAGTGGG + Intergenic
993566146 5:89477835-89477857 TTTAAAGGAAAGAAAGAACTAGG + Intergenic
995204567 5:109464520-109464542 CTTGAAGGTAATAATAAACCAGG - Intergenic
995328352 5:110918013-110918035 CTTGAAGGCATTAAATGACCAGG + Intergenic
996091676 5:119357417-119357439 GTTGAAGGCAAATAGGAACCAGG + Intronic
998919927 5:147056824-147056846 CTGGAAGGCAAGAAAGCACAGGG + Intronic
999811218 5:155129111-155129133 CTAAAAGGTAAGAAAGAACATGG - Intergenic
1000638384 5:163670324-163670346 ATTGAAGACAGGAAAGAAGCTGG - Intergenic
1000739032 5:164941709-164941731 CTTGCATGCGAGAAACAACCAGG - Intergenic
1002446193 5:179291466-179291488 CTTGGAGGCAAGAGAGGACACGG - Intronic
1004554284 6:16680517-16680539 CTTCAAGGGAAGAAGGACCCAGG + Intronic
1004785592 6:18964128-18964150 CTTGAAGGAGAGAGAGAATCAGG - Intergenic
1008984247 6:57523389-57523411 CATGGAGGCATAAAAGAACCAGG - Intronic
1009172300 6:60416267-60416289 CATGGAGGCATAAAAGAACCAGG - Intergenic
1010219913 6:73439679-73439701 GATGAAGGAAAGAGAGAACCAGG + Intronic
1010477213 6:76302824-76302846 CTGGAAAGCAAAAAAGAACAGGG - Intergenic
1011543146 6:88455259-88455281 CTTGAAGGCAAGAAAGAGGTAGG - Intergenic
1011710819 6:90052383-90052405 CTTTAAGGCAAAAAAAAATCAGG - Intronic
1013317029 6:108953068-108953090 CCTGACGGCAAAAAATAACCAGG + Exonic
1014087344 6:117362603-117362625 CTGGAAGGCAATAAAGCATCTGG + Exonic
1015251464 6:131132356-131132378 TATGAAAGCAAAAAAGAACCAGG + Intergenic
1015419911 6:132995575-132995597 TGTGAAGGCAAGGAAGAGCCTGG + Intergenic
1015571590 6:134626663-134626685 CTTGAATGCCAGAGAGAGCCAGG - Intergenic
1015710354 6:136132427-136132449 CTTCAAGGTCAGAAAGACCCAGG + Intronic
1017339828 6:153308068-153308090 CTAGAAAGCAAGAAAGACCATGG - Intergenic
1017695901 6:157015899-157015921 CTTGAAGGCAATGAAGATGCAGG - Intronic
1018369249 6:163152509-163152531 CATGAAGGCAAAATAGAAACAGG - Intronic
1018579002 6:165291366-165291388 CATGGAGGTAAGAAAGAACTTGG + Intronic
1019429143 7:990773-990795 CTTGAAGGGCAGAAAGAACGGGG + Intergenic
1021117046 7:16755312-16755334 TTTGAAGGCAAGACAGAAACAGG + Intronic
1021731819 7:23603000-23603022 ATTTAAGGCATGAAAGAACTTGG - Intronic
1023481591 7:40640904-40640926 CTGGAAGCCAAGGAAGGACCTGG + Intronic
1024477758 7:49831904-49831926 CAACAAGGCTAGAAAGAACCAGG + Intronic
1024626271 7:51210584-51210606 CTTGGTGGCATTAAAGAACCTGG + Intronic
1028243315 7:88447543-88447565 CTTGATGGCGAGAAACAACAAGG + Intergenic
1031716833 7:125118625-125118647 GTTGAAGGCAAAGAGGAACCTGG - Intergenic
1036272788 8:7322691-7322713 GTGGAAGGCAAGACAGAAGCAGG - Intergenic
1036348562 8:7987657-7987679 GTGGAAGGCAAGACAGAAGCAGG + Intergenic
1036865201 8:12390441-12390463 GTGGAAGGCAAGACAGAAGCAGG + Intergenic
1037796546 8:22000186-22000208 CCTGTAGGCAAGAAAGAACCAGG + Intronic
1038654315 8:29435190-29435212 CATGAAGGCAAGAATGAACTAGG + Intergenic
1038762572 8:30397965-30397987 CCTAAAGGAAAGAAAAAACCAGG + Intronic
1039858165 8:41434419-41434441 CAGGAGGGCAGGAAAGAACCCGG + Intergenic
1040903653 8:52442339-52442361 CTTAAAGAGAAGAAAGAACCTGG + Intronic
1042186877 8:66145132-66145154 CTTGAAGCCAAGAAAGATTAGGG + Intronic
1042688196 8:71464319-71464341 ATTAAAGGCAAGTAAGAACATGG - Intronic
1045990026 8:108295934-108295956 GTTGAAGGCAAGAAGGAGACAGG - Intronic
1050012404 9:1198516-1198538 CTTGGAGGCAAGAAAAGTCCAGG + Intergenic
1051784276 9:20724871-20724893 CTTAAAGGCAAGAATGGGCCAGG + Intronic
1051822692 9:21186448-21186470 CCTGAAGGCAACATATAACCAGG + Intergenic
1051824244 9:21201075-21201097 CATGAAGGCAACAGATAACCTGG + Intergenic
1051824585 9:21206023-21206045 CCTGAAGGCAACATATAACCAGG + Intergenic
1051826521 9:21227086-21227108 CTTGAAGGCAACATATAACCAGG + Intronic
1053092251 9:35289440-35289462 CTGTAAGGCAAGCAAAAACCTGG + Intronic
1057820273 9:98324775-98324797 ATTGCAGGCAGGCAAGAACCTGG - Intronic
1057822023 9:98339893-98339915 CCAGAAGGAAAGAGAGAACCAGG - Intronic
1057980048 9:99651190-99651212 CATAAAGGTGAGAAAGAACCAGG + Intergenic
1060976242 9:127766863-127766885 CGTGAAGGAAGGAAAGAAGCTGG - Intronic
1061071129 9:128311382-128311404 CTTAATGCCAAGAAAGAAACAGG + Intronic
1061237000 9:129349129-129349151 CCTGCAGGGAAGAAAGAGCCTGG + Intergenic
1185466582 X:358629-358651 CTTTAAGACTTGAAAGAACCTGG - Intronic
1186290154 X:8088721-8088743 CTGAAGGGGAAGAAAGAACCAGG - Intergenic
1189015154 X:37089204-37089226 CCTAAAGGAAAGAAAAAACCAGG + Intergenic
1192307781 X:69981555-69981577 ATTGAAGGCATGCAAGAAGCAGG + Intronic
1193259030 X:79383172-79383194 CCAGAAGACAAGAAATAACCAGG + Intergenic
1193967746 X:88009239-88009261 ATGGAAGGCAAGAAAAAAGCAGG + Intergenic
1194223732 X:91228106-91228128 CATGAAGGCAACACAGAACTGGG - Intergenic
1195603948 X:106780778-106780800 CTTTAAAGCCAGATAGAACCTGG + Intronic
1196226320 X:113171453-113171475 ATTAAAAGCAACAAAGAACCAGG - Intergenic
1196904865 X:120421093-120421115 GCAGAATGCAAGAAAGAACCAGG + Intergenic
1196948462 X:120851732-120851754 CTAGAAGGAAAAAAAGAACATGG + Intergenic
1198673692 X:139109149-139109171 AATGAATGCAAGGAAGAACCAGG + Intronic
1198882926 X:141300925-141300947 CTTGCAGGCAGGAGAGAACATGG + Intergenic
1199095446 X:143733295-143733317 CTTGAAAGTAAGAAAGAATGGGG - Intergenic
1199100315 X:143791764-143791786 GTTGAAGAAAAGAAAAAACCTGG + Intergenic
1199819218 X:151428066-151428088 CTTGGTGGCGAGAAAGAGCCAGG + Intergenic
1200063346 X:153493563-153493585 CATGAAATCAAGAGAGAACCAGG + Intronic
1200243126 X:154508093-154508115 CATGATGGCAATAAAGAACTAGG - Intronic
1200757408 Y:7002844-7002866 TTTGCAGGGAAGAAAGAAACAGG + Intronic
1201349649 Y:13025562-13025584 CTTGGAGGCAAGAAGGAAATAGG - Intergenic