ID: 1093000474

View in Genome Browser
Species Human (GRCh38)
Location 12:13990482-13990504
Sequence GGGGCCACTGCAGTGTTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093000474_1093000477 -8 Left 1093000474 12:13990482-13990504 CCATGCAACACTGCAGTGGCCCC No data
Right 1093000477 12:13990497-13990519 GTGGCCCCCGGATAATGCAAGGG No data
1093000474_1093000476 -9 Left 1093000474 12:13990482-13990504 CCATGCAACACTGCAGTGGCCCC No data
Right 1093000476 12:13990496-13990518 AGTGGCCCCCGGATAATGCAAGG No data
1093000474_1093000487 25 Left 1093000474 12:13990482-13990504 CCATGCAACACTGCAGTGGCCCC No data
Right 1093000487 12:13990530-13990552 CTACACTTTGAGTTTAGATTGGG No data
1093000474_1093000478 -7 Left 1093000474 12:13990482-13990504 CCATGCAACACTGCAGTGGCCCC No data
Right 1093000478 12:13990498-13990520 TGGCCCCCGGATAATGCAAGGGG No data
1093000474_1093000486 24 Left 1093000474 12:13990482-13990504 CCATGCAACACTGCAGTGGCCCC No data
Right 1093000486 12:13990529-13990551 CCTACACTTTGAGTTTAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093000474 Original CRISPR GGGGCCACTGCAGTGTTGCA TGG (reversed) Intergenic
No off target data available for this crispr