ID: 1093002285

View in Genome Browser
Species Human (GRCh38)
Location 12:14010979-14011001
Sequence TAAAAGAAACATTATGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093002283_1093002285 22 Left 1093002283 12:14010934-14010956 CCGTGACACACACTGGAGGCTCA No data
Right 1093002285 12:14010979-14011001 TAAAAGAAACATTATGAGGTTGG No data
1093002281_1093002285 24 Left 1093002281 12:14010932-14010954 CCCCGTGACACACACTGGAGGCT No data
Right 1093002285 12:14010979-14011001 TAAAAGAAACATTATGAGGTTGG No data
1093002282_1093002285 23 Left 1093002282 12:14010933-14010955 CCCGTGACACACACTGGAGGCTC No data
Right 1093002285 12:14010979-14011001 TAAAAGAAACATTATGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093002285 Original CRISPR TAAAAGAAACATTATGAGGT TGG Intergenic
No off target data available for this crispr