ID: 1093003613

View in Genome Browser
Species Human (GRCh38)
Location 12:14027649-14027671
Sequence TAATATAGCATTTTCTTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093003613_1093003615 15 Left 1093003613 12:14027649-14027671 CCTATCAAGAAAATGCTATATTA No data
Right 1093003615 12:14027687-14027709 TTAAGAAGATGTAGAAGTAGTGG No data
1093003613_1093003618 25 Left 1093003613 12:14027649-14027671 CCTATCAAGAAAATGCTATATTA No data
Right 1093003618 12:14027697-14027719 GTAGAAGTAGTGGGGCACAGTGG No data
1093003613_1093003616 16 Left 1093003613 12:14027649-14027671 CCTATCAAGAAAATGCTATATTA No data
Right 1093003616 12:14027688-14027710 TAAGAAGATGTAGAAGTAGTGGG No data
1093003613_1093003617 17 Left 1093003613 12:14027649-14027671 CCTATCAAGAAAATGCTATATTA No data
Right 1093003617 12:14027689-14027711 AAGAAGATGTAGAAGTAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093003613 Original CRISPR TAATATAGCATTTTCTTGAT AGG (reversed) Intergenic
No off target data available for this crispr