ID: 1093003617

View in Genome Browser
Species Human (GRCh38)
Location 12:14027689-14027711
Sequence AAGAAGATGTAGAAGTAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093003613_1093003617 17 Left 1093003613 12:14027649-14027671 CCTATCAAGAAAATGCTATATTA No data
Right 1093003617 12:14027689-14027711 AAGAAGATGTAGAAGTAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093003617 Original CRISPR AAGAAGATGTAGAAGTAGTG GGG Intergenic
No off target data available for this crispr