ID: 1093007173

View in Genome Browser
Species Human (GRCh38)
Location 12:14063342-14063364
Sequence GCTGAAACCCAACCAGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093007173_1093007177 -4 Left 1093007173 12:14063342-14063364 CCAGCTTCTGGTTGGGTTTCAGC No data
Right 1093007177 12:14063361-14063383 CAGCCAATGAGGGGACATAGTGG No data
1093007173_1093007179 5 Left 1093007173 12:14063342-14063364 CCAGCTTCTGGTTGGGTTTCAGC No data
Right 1093007179 12:14063370-14063392 AGGGGACATAGTGGAAGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093007173 Original CRISPR GCTGAAACCCAACCAGAAGC TGG (reversed) Intergenic
No off target data available for this crispr