ID: 1093018183

View in Genome Browser
Species Human (GRCh38)
Location 12:14175952-14175974
Sequence TGTTATGGCTACGGAGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093018183_1093018193 23 Left 1093018183 12:14175952-14175974 CCAGTCCCTCCGTAGCCATAACA No data
Right 1093018193 12:14175998-14176020 ATAGCATACTGGTGTTTAAGGGG No data
1093018183_1093018192 22 Left 1093018183 12:14175952-14175974 CCAGTCCCTCCGTAGCCATAACA No data
Right 1093018192 12:14175997-14176019 AATAGCATACTGGTGTTTAAGGG No data
1093018183_1093018188 -2 Left 1093018183 12:14175952-14175974 CCAGTCCCTCCGTAGCCATAACA No data
Right 1093018188 12:14175973-14175995 CACTAATACGTCTCTCTCCTAGG No data
1093018183_1093018191 21 Left 1093018183 12:14175952-14175974 CCAGTCCCTCCGTAGCCATAACA No data
Right 1093018191 12:14175996-14176018 CAATAGCATACTGGTGTTTAAGG No data
1093018183_1093018189 12 Left 1093018183 12:14175952-14175974 CCAGTCCCTCCGTAGCCATAACA No data
Right 1093018189 12:14175987-14176009 TCTCCTAGGCAATAGCATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093018183 Original CRISPR TGTTATGGCTACGGAGGGAC TGG (reversed) Intergenic
No off target data available for this crispr