ID: 1093018848

View in Genome Browser
Species Human (GRCh38)
Location 12:14184513-14184535
Sequence TTAAATAAGCGTGGGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093018848_1093018853 -1 Left 1093018848 12:14184513-14184535 CCATGCTCCCCACGCTTATTTAA No data
Right 1093018853 12:14184535-14184557 ACACCACTGGAGATTCTAGCTGG No data
1093018848_1093018858 29 Left 1093018848 12:14184513-14184535 CCATGCTCCCCACGCTTATTTAA No data
Right 1093018858 12:14184565-14184587 AGGCAAGAAAAAGAAGTACATGG No data
1093018848_1093018855 1 Left 1093018848 12:14184513-14184535 CCATGCTCCCCACGCTTATTTAA No data
Right 1093018855 12:14184537-14184559 ACCACTGGAGATTCTAGCTGGGG No data
1093018848_1093018857 9 Left 1093018848 12:14184513-14184535 CCATGCTCCCCACGCTTATTTAA No data
Right 1093018857 12:14184545-14184567 AGATTCTAGCTGGGGCAATAAGG No data
1093018848_1093018854 0 Left 1093018848 12:14184513-14184535 CCATGCTCCCCACGCTTATTTAA No data
Right 1093018854 12:14184536-14184558 CACCACTGGAGATTCTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093018848 Original CRISPR TTAAATAAGCGTGGGGAGCA TGG (reversed) Intergenic
No off target data available for this crispr