ID: 1093019327

View in Genome Browser
Species Human (GRCh38)
Location 12:14188550-14188572
Sequence GAACTCAGCTTTTAAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093019325_1093019327 11 Left 1093019325 12:14188516-14188538 CCACCAGACACTGTTGGAAGATA No data
Right 1093019327 12:14188550-14188572 GAACTCAGCTTTTAAAAAGCAGG No data
1093019326_1093019327 8 Left 1093019326 12:14188519-14188541 CCAGACACTGTTGGAAGATAGAA No data
Right 1093019327 12:14188550-14188572 GAACTCAGCTTTTAAAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093019327 Original CRISPR GAACTCAGCTTTTAAAAAGC AGG Intergenic
No off target data available for this crispr