ID: 1093024888

View in Genome Browser
Species Human (GRCh38)
Location 12:14236554-14236576
Sequence ACTTGAGGCGAAAATTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093024888_1093024893 29 Left 1093024888 12:14236554-14236576 CCCCCAAAATTTTCGCCTCAAGT No data
Right 1093024893 12:14236606-14236628 CATTATTAACATAAAAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093024888 Original CRISPR ACTTGAGGCGAAAATTTTGG GGG (reversed) Intergenic
No off target data available for this crispr